Технические характеристики дз 27: Бульдозер ДЗ 27 технические характеристики, цена, видео, фото

Содержание

171, 110, 27, 18, 42Г, 28, 109, 170, 162, 8, 25, 53, 171-1, 110А, 101, технические характеристики, цены, аналоги

На рынке представлено несколько модификаций бульдозера ДЗ: 42, 170, 171 и т. д. Каждая модель отличается техническими характеристиками и показателями. Это транспортное средство используется для выполнения работ на промышленных и строительных площадках, в карьере и в сельском хозяйстве.

Бульдозер ДЗ 18

Бульдозер ДЗ 18 – универсальная транспортно-землеройная техника, основанная на гусеничном тракторе с добавлением органов управления и навесного оборудования. Машина является продуктом Челябинского завода дорожных машин, выпускающего также скреперы, трактора и автогрейдеры. Предприятие является одним из старейших на отечественном рынке (образовано в 1898 году). В военное время на нем выпускали машины для армии, после нее производство было переоборудовано. Продукция Челябинского завода отличается высоким качеством и надежностью.

Бульдозер ДЗ 18 нельзя отнести к числу наиболее популярных моделей бренда. Машина представляет легкий сегмент и может использоваться в различных климатических зонах с температурой до -40 градусов.

Интересные факты

Используются трактора Т-25 в наше время на самом деле очень широко. К примеру, именно эти отечественный бульдозеры участвовали когда-то в одной из самых масштабных строек нулевых — прокладке газовых труб «Голубой поток». Эта очень важная для экономики страны магистраль была протянута в Турцию по дну Черного моря в 2001-2002 г.

Также бульдозеры Т-25 широко использовались при прокладке трубопровода «Сахалин-2». По этому проекту было разработано два нефтяных шельфовых месторождения. Его реализация началась в 1996 г. Второй этап проекта закончился в конце нулевых. Прокладывался трубопровод в те времена в южную часть острова Сахалин, где затем были построены терминалы отгрузки нефти и газоперерабатывающий завод.

Навесное оборудование

Универсальность данного трактора объясняется довольно большим количеством навесного оборудования, с которым машина могла принимать участие в работах того или иного вида.

Навесное устройство трактора предусматривало установку следующих навесных агрегатов:

  1. Фронтальный бульдозерный отвал. Данное оборудование чаще всего являлось базовым, но его также можно было приобрести отдельно от машины. Этот отвал обладает довольно простой конструкцией, он способен лишь подниматься и опускаться, а изменений поворота, перекоса и прочих функций он не имеет. Проще говоря, это прямой отвал.
  2. Разнообразное плужное оборудование.
  3. Навесные культиваторы.
  4. Боронировочное оборудование.
  5. Корчеватели.
  6. Трубоукладчики.

Назначение

Гусеничный трактор Т-100 во времена своего серийного производства пользовался довольно большой популярностью практически во всех областях, а именно он исправно трудился в строительстве каких-либо объектов, выполнял различные задачи промышленных отраслей, осуществлял поставленные задачи в сельских хозяйствах, а также проделывал разные виды работы в лесных хозяйствах. Эту машину по праву можно назвать легендарной.

Трактор предназначался для таких работ, как разравнивание рабочих площадок, перемещение сыпучих масс грунта и других подобных материалов на небольшие расстояния, вспахивание полей с грунтом различной плотности, культивирование, боронирование, подготовка почвы к посеву, посев и многое другое.

После выхода болотоходной версии (о ней речь пойдет позже), трактору открылась работа на болотистых участках, торфяниках и на вязких грунтах.

Кабина

Оператор каждый день проводит в кабине бульдозера от 8-ми до 12-ти часов. Поэтому не меньше усилий, чем на совершенство отвала и трансмиссии, разработчики тратят на то, чтобы поставить полнофункциональные кабины, которые бы делали работу человека максимально комфортной.

John Deere 850L оборудован вентиляцией, обогревом и удобным креслом с высокой спинкой и кожаной обивкой. Температура в кабине устанавливается трактористом один раз, в начале рабочего дня. После этого о ней можно не беспокоиться, автоматика будет до конца смены поддерживать необходимое значение. Гидростатическая трансмиссия является отличным примером упрощения управления машиной. Если нагрузка на отвал оказывается слишком большой, то блок управления подачей топлива регулирует трансмиссию так, чтобы число оборотов двигателя было оптимальным для данной ситуации. Оператору не нужно ничего переключать.

Case ставит на свои бульдозеры электрогидравлические джойстики. Они повышают степень «отзывчивости» техники на управляющие команды. Большой диапазон настроек также облегчает труд оператора, потому что дает возможность наилучшим образом адаптировать работу машины к условиям конкретного участка, в зависимости от твердости грунта и других параметров. Современные технологии управления бульдозерами вообще и отвалами в частности обрабатывают выполненные ранее задания и сохраняют настройки. Если трактор работает в аналогичной обстановке, то, с помощью комплекта «IMU + набор проводов + дисплей» можно быстро настроить, а потом автоматически поддерживать необходимое расположение отвала.

Для движения бульдозера не нужны никакие мачты, лазеры или GPS.

Liebherr герметизирует кабину, «отделяя» ее от остального трактора. Плюс максимально понижает уровень шума и вибрации трансмиссии. Для управления задним рыхлителем предусмотрена удобная рукоятка со встроенным джойстиком. А для того, чтобы повысить безопасность оператора, рабочий орган опускается с задержкой. Все контрольные данные по рабочему процессу выводятся на новый 9-дюймовый монитор.

Современный бульдозер сильно отличается от Т-74 с отвалом семидесятых годов прошлого столетия. Сегодня это машина, управляемая электроникой. Каждый ее узел спроектирован так, чтобы не только повысить производительность, но и максимально облегчить работу оператора.

Устройство и особенности эксплуатации

Бульдозер ДЗ 18 построен на базовом тракторе Т-100МЗГП (последняя модификация модели Т-100), оборудованном гидросистемой и гидроцилиндрами, отвалом с козырьком, толкающими брусьями и ножами. Верхняя часть отвала имеет соединение винтовыми раскосами с толкающими брусьями, что обеспечивает возможность изменения угла резания и поперечного перекоса.

Соединение с толкающими брусьями достигается при помощи специальных плит с опорными пальцами.

Конструктивно бульдозер ДЗ 18 копировал трактор Т-100МЗГП с незначительными изменениями. Расположение устройств было стандартным: спереди крепился двигатель, сзади – кабина. Для модели было характерно сложное устройство ходовой части. Жесткая подвеска включала гусеничную тележку с гусеницами и балансирным грузом. Основу конструкции составляла сварная рама коробчатого сечения. Соединение звеньев гусеничной цепи выполнялось пальцами и втулками. Гусеничная часть получила башмаки со специальным профилем, повышающим проходимость. Цепь устанавливалась на поддерживающие и опорные катки и колеса с механизмом натяжения. В ДЗ 18 применялись бортовые тормоза. Бульдозер комплектовался гидравлическими сервомеханизмами управления поворотами. Ходовая часть бульдозера отличалась надежность и показывала высокую проходимость.

Трансмиссия машины имела классическую для большинства моделей Челябинского завода конструкцию. Механическая реверсивная трехходовая коробка передач позволяла двигаться в диапазоне 5 передних и 4 задних скоростей. Контроль сухого однодискового сцепления выполнялся специальным рычагом из кабины посредством рычажно-кулачкового механизма. Муфта сцепления была выполнена в виде отдельного узла, потому ее демонтаж не представлял особого труда. На нижнем вале коробки располагалась центральная коническая передача. Поворотные муфты были многодисковыми сухими с ведомыми дисками с фрикционными накладками.

Кабина бульдозера ДЗ 18 характеризовалась минимумом удобств. Она имела средние размеры и монтировалась на жесткой раме. В салоне устанавливалось мягкое кресло оператора. Внутри также присутствовала система принудительной вентиляции, отопитель и освещение.

Бульдозер ДЗ 18 оборудовался системой Автоплан-1, обеспечивающей автоматическую стабилизацию положения отвала. Механизм контролировал заданный угол в продольном направлении, улучшая планирующие показатели машины. С включенной системой машина обычно применялась на планировочных операциях, с выключенной – на классических бульдозерных работах.

Автоматическая система управления предполагает включение в гидропривод специального гидронасоса, предохранительного и замедлительного гидроклапана и гидрораспределителей. В автономном режиме гидропровод выполняет перекос и перемещение отвала по специальным командам с большой точностью планировки (до 50 мм). Индикаторы и пульт управления системой установлены в салоне. С использованием пульта задается поперечный и продольный уклон и преобразование сигналов в команды управления, подаваемые на электромагниты гидрораспределителя. Автоматический режим выбирается кнопкой «автомат», подъем и опускание – посредством переключателя «вниз-вверх».

В качестве базового оборудования для модели ДЗ 18 предусмотрен поворотный отвал. Однако техника может работать с другим оборудованием.

Производитель

Занимается выпуском этих машин отечественное предприятие «Промтрактор», производственные мощности которого находятся в Чебоксарах. Строительство этого завода началось еще во времена СССР — в 1972 г.

Первый бульдозер с конвейера предприятия же сошел в 1975 г. Под брендом «Четра» трактора завод поставляет на рынок с 2002 г. Бульдозеры этой марки импортируются сегодня в том числе и за рубеж. При этом за границей, как и в России, они пользуются огромным успехом.

Схемы установки

Установка РТ-ДО в системах отопления

Установка РТ-ДО в системах автоматического поддержания температуры

Перед устройством регулирования РТ-ДЗ-25 рекомендуют установить сетчатый фильтр.

Габаритные размеры

ПараметрDyD1D2D3D4D5D6Hh2h3hh2L, мм
Размер, мм25115348085
14
6529515547027064160±1,0

Описание машины

Судя по отзывам потребителей, бульдозер «Четра Т-25», технические характеристики которого будут рассмотрены нами в статье, отличается прежде всего функциональностью и легкостью в обслуживании. К плюсам этой машины относят также то, что ее мощный двигатель можно менять на моторы практически от любых других производителей.

Также бульдозер «Четра Т-25» , судя по отзывам, отличается хорошей маневренностью. Изготавливается этот модернизированный трактор с основными узлами на базе модуля. Это облегчает машину и делает ее более производительной. Помимо всего прочего, двигатель «Четра Т-25» дополняется специальными подогревателями, гарантирующими бесперебойную работу при пониженных температурах.

Гидравлическая система этого трактора управляется посредством электронной панели. При этом регулируется она с учетом нагрузки.

Разрабатывая эту модель, инженеры-конструкторы акцентировали особое внимание на ее проходимости. Эта машина, помимо всего прочего, отличается уменьшенным уровнем давления на опорную поверхность. Гусеницы при этом на бульдозере установлены расширенные с увеличенным количеством катков. Регулировать последние, как и бортовые фрикционы, при работе трактора «Четра Т-25» не нужно.

Одной из особенностей Т-25 является то, что с его использованием можно производить работы по диагональной тяге абсолютно на любой местности. Отвал к капоту у этого трактора приближается на минимальное расстояние.

Помимо базовой модели, выпускает и несколько ее модификаций. К примеру, достаточно популярной моделью у потребителей является бульдозер Т-25 01. Эта модель отличается в первую очередь большой производительностью.

Разработка и перемещение нескального грунта бульдозерами

Главная > Разработка и перемещение нескального грунта бульдозерами

Таблица 1

Техническая характеристика бульдозеров

Марка бульдозера
Наиме

нование показа

теля

ДЗ-29 

(Д-535)

ДЗ-42 

(Д-606)

ДЗ-8 

(Д-271-А)

ДЗ-19 

(Д-494А)

ДЗ-17 

(Д-492А)

ДЗ-18 

(Д-493А)

ДЗ-53 

(Д-686)

ДЗ-54С 

(Д-687С)

Тип отвалаНеповоротныйПоворотныйНеповоротный
Длина

отвала, м

2,562,563,033,033,943,973,23,2
Высота

отвала, м

0,80,811,11,3111,21,2
Управле

ние

ГидравлическоеКанатноеГидравлическоеКанатноеГидравлическоеКанатноеГидравлическое
Мощность,

кВт (л. с.)

55 (75)79 (108)
Марка

трактора

Т-74ДТ-75Т-100
Масса бульдо

зерного обору

дования, т

0,851,071,581,532,221,862,131,78

 

Марка бульдозера
Наиме

нование

показателя

Д-259ДЗ-101ДЗ-104ДЗ-27С 

(Д-532С)

ДЗ-110 

ДЗ-110А

ДЗ-28 

(Д-533)

ДЗ-109, 

ДЗ-109Б

ДЗ-9 

(Д-275А)

ТипотвалаПоворотныйНеповоротныйПоворотныйНеповоротныйПоворотныйНеповоротный
Длина

отвала, м

4,152,863,283,23,23,944,123,35
Высота отвала, м1,10,950,991,31,311,141,1
УправлениеКанатноеГидравлическоеКанатное
Мощность,

кВт (л. с.)

79 (108)96 (130)118 (160)118 (160)132 (180)
Марка

трактора

Т-100Т4-АП1Т-130Т-130Т-180
Масса

бульдозер

ного оборудо

вания, т

2,271,441,771,912,282,852,642,56

 

Марка бульдозера
Наимено

вание

показателя

ДЗ-24 

(Д-521)

ДЗ-35С 

(Д-575С)

ДЗ-24А 

(Д-521А)

ДЗ-25 

(Д-522)

Д-290Д-384Д-385ДЗ-34С 

(Д-572С)

ДЗ-118
Тип отвалаНеповоротныйПоворотныйНеповоротныйПоворотныйНеповоротный
Длина

отвала, м

3,363,643,644,434,594,54,534,544,31
Высота

отвала, м

1,11,291,431,21,271,41,41,551,55
УправлениеГидравлическоеКанатноеГидравлическоеКанатноеГидравлическое
Мощность,

кВт (л. с.)

132 (180)221 (300) — 228 (310)250 (340)
Марка трактораТ-180ДЭТ-250ДЭТ-250М
Масса бульдо

зерного обору

дования, т

1,963,42,862,853,512,84,53,984,8

Указания по применению норм

Нормами предусмотрена разработка грунта в резервах, выемках и котлованах.
Окончательное разравнивание и уплотнение грунта нормами настоящего параграфа не учтено и нормируется отдельно в зависимости от способа разравнивания.
Перемещение ранее разработанных разрыхленных грунтов (уборка излишков грунта при планировках, перемещение грунта из отвала и др. ) следует нормировать по нормам настоящего параграфа с применением коэффициента согласно примеч.3.

Состав работы

1. Приведение агрегата в рабочее положение. 2. Разработка грунта с перемещением его и выгрузкой.3. Возвращение бульдозера в забой порожняком.

Состав рабочих

Для бульдозеров на тракторах ДТ-75; Т-74

Машинист 5 разр.

Для бульдозеров на тракторах Т-100, Т-4АП1, Т-130, Т-180 и ДЭТ-250

Машинист 6 разр.

Таблица 2

Нормы времени и расценки на 100 м³ грунта

Расстояние перемещения грунта
Марка трактораМарка бульдозерадо 10 мдобавлять на каждые следующие 10 м
Группа грунта
IIIIIIIIIIII
ДТ-75, 

Т-74

ДЗ-42 

(Д-606),

ДЗ-29

(Д-535)

0,94 

(0,94)

0-85,5

1,1 

(1,1)

1-00

1,3 

(1,3)

1-18

0,87 

(0,87)

0-79,2

0,94 

(0,94)

0-85,5

0,98 

(0,98)

0-89,2

1
ДЗ-8 

(Д-271),

ДЗ-19

(Д-494)

0,55 

(0,55)

0-58,3

0,68 

(0,68)

0-72,1

0,78 

(0,78)

0-82,7

0,48 

(0,48)

0-50,9

0,54 

(0,54)

0-57,2

0,56 

(0,56)

0-59,4

2
Т-100Д-259, 

ДЗ-18

(Д-493А),

ДЗ-17

(Д-492А),

ДЗ-53

(Д-686),

ДЗ-54С

(Д-687С)

0,5 

(0,5)

0-53

0,62 

(0,62)

0-65,7

0,7 

(0,7)

0-74,2

0,43 

(0,43)

0-45,6

0,49 

(0,49)

0-51,9

0,51 

(0,51)

0-54,1

3
Т-4АП1ДЗ-101, 

ДЗ-104

0,88 

(0,88)

0-93,3

(1)

1-06

1,1 

(1,1)

1-17

0,74 

(0,74)

0-78,4

0,84 

(0,84)

0-89

0,87 

(0,87)

0-92,2

4
Т-130ДЗ-27С 

(Д-532С),

ДЗ-110A ,

ДЗ-28

(Д-533)

0,35 

(0,35)

0-37,1

0,41 

(0,41)

0-43,5

0,47 

(0,47)

0-49,8

0,3 

(0,3)

0-31,8

0,33 

(0,33)

0-35

0,35 

(0,35)

0-37,1

5
Т-180ДЗ-25 

(Д-522),

Д-290,

ДЗ-24

(Д-521),

ДЗ-9

(Д-275),

ДЗ-35С

(Д-575С)

0,32 

(0,32)

0-33,9

0,38 

(0,38)

0-40,3

0,4 

(0,4)

0-42,4

0,29 

(0,29)

0-30,7

0,3 

(0,3)

0-31,8

0,32 

(0,32)

0-33,9

6
ДЗ-24А 

(Д-521А)

0,27 

(0,27)

0-28,6

0,32 

(0,32)

0-33,9

0,36 

(0,36)

0-38,2

0,24 

(0,24)

0-25,4

0,27 

(0,27)

0-28,6

0,28 

(0,28)

0-29,7

7
ДЭТ-250Д-384, 

Д-385

0,25 

(0,25)

0-30,3

0,28 

(0,28)

0-33,9

0,32 

(0,32)

0-38,7

0,22 

(0,22)

0-26,6

0,23 

(0,23)

0-27,8

0,24 

(0,24)

0-29

8
ДЗ-34С 

(Д-572С)

0,22 

(0,22)

0-26,6

0,24 

(0,24)

0-29

0,27 

(0,27)

0-32,7

0,2 

(0,2)

0-24,2

0,21 

(0,21)

0-25,4

0,22 

(0,22)

0-26,6

9
абвгдеN

Примечания: 1. Нормы и расценки предусматривают работу бульдозерами без открылков. При перемещении грунта бульдозерами с отвалами ящичного типа Н. вр. и Расц. умножать на 0,87 (ПР-1).2. Нормами и расценками предусмотрена работа бульдозеров в грунтах естественной влажности. При работе бульдозеров в сыпучих или вязких грунтах, в которыхбуксуют или вязнут гусеницы тракторов, Н. вр. и Расц.умножать на 1,15 (ПР-2). 3. При перемещении бульдозером ранее разработанных разрыхленных грунтов Н. Вр. и Расц. умножать на 0,85, считая объем грунта в естественном залегании (ПР-3). 4. Нормами и расценками учтено перемещение грунта по пути с подъемом до 10%. При подъемах до 20% длину пути на участках с подъемом умножать на 1,2, а при подъемахсв.20% — на 1,4 (ПР-4).

Автогрейдеры|ДЗ-98|ДЗ-98В.00100-110

ДВИГАТЕЛЬ

Тип

Дизельный

Модель при установке механической трансмиссии,  Номинальная мощность,кВт (л. с.), Номинальная частота вращения

ЯМЗ-238НДЗ, 173 (240л.с.),  1700 об/мин

 

Пуск

Стартерный 

ХОДОВАЯ ЧАСТЬ

Колесная формула

1x3x3

Ведущие мосты

3

Управляемый мост

Передний

Главная передача мостов

Одноступенчатая, коническая, без дифференциалов

Бортовые редукторы мостов

 

Одноступенчатые, цилиндрические, с внутренним зацеплением

Полуоси

Полностью разгруженного типа

Колесные тормоза

Многодисковые работающие в масляной ванне

Подвеска среднего и заднего мостов

Балансирная с реактивными штангами, обеспечивающая качание мостов в вертикальной плоскости

Подвеска переднего моста

 

Шарнирная, обеспечивающая качание моста в поперечной плоскости

Размер шин, дюйм

16,00-24 или 20,5-25

Давление в шинах, МПа (кгс/см 2)

0,23-0,28 (2,3-2,8)

ТРАНСМИССИЯ

Тип

Механическая, с приводом на все колеса, с механизмом отключения переднего моста

Редуктор привода гидронасосов

Однорядный с упругой соединительной муфтой

Сцепление

Сухое, двухдисковое, постоянно замкнутое с гидросервированием его привода, с тормозком ведомого вала

Раздаточный редуктор

Однорядный для привода среднего и заднего мостов со стояночным тормозом

Стояночный тормоз

Дискового типа

Промежуточные передачи к мостам

Карданные

Количество передач автогрейдера:

— при движении вперед

— при движении назад

 

6

6

Скорости движения автогрейдера

при номинальной частоте вращения

коленчатого вала двигателя, км/ч:

 — при движении вперед:

I передача

II передача

III передача

IV передача

V передача

VI передача

 

 

 

 

4,2

6,8

10,5

16,5

27,0

41,0

— при движении назад:

I передача

II передача

III передача

IV передача

V передача

VI передача

 

5,2

8,2

12,5

20,5

32,0

48,5

Минимальный радиус поворота при движении по сухой бетонированной поверхности, м

18

Уклон удержания автогрейдера стояночным тормозом, %

не менее 20

 

УПРАВЛЕНИЕ

Управление коробкой передач, мультипликатором, реверсом и передним мостом

механическое

Управление ГМП

контроллер (рукоятка управления)

Управление сцеплением

механическое с гидроусилителем

Управление поворотом передних колес

гидравлическое

Управление тормозами:

— Колесными

— Стояночным

 

пневматическое

механическое

Управление рабочими органами

гидравлическое

ЭЛЕКТРООБОРУДОВАНИЕ

Напряжение

В 24

Мощность стартера, кВт (л. с.)

8,2 (11,2)

Аккумуляторные батареи:

— тип

— количество

 

6СТ-190А

 2

ВМЕСТИМОСТЬ ЗАПРАВОЧНЫХ ЕМКОСТЕЙ

Топливный бак, л

345

Система охлаждения и подогрева двигателя, л

72; 50

Система смазки двигателя, л

32

Гидросистема автогрейдера, л

150/170

Коробка передач, редуктор привода гидронасосов, раздаточный редуктор, л

35

Главная передача заднего, среднего мостов (каждого), л

7

Главная передача переднего моста, л

15

Бортовой редуктор переднего моста (каждый), л

8,6

Колесный тормоз, л

3,6

Предохранитель пневмосистемы против замерзания, л

0,2

Редуктор поворота отвала, л

3

ГАБАРИТЫ

Габаритные размеры, мм (д/ш/в)      

10 690/3 250/4 000

Ширина (отвал в транспортном положении), мм

3 220

 

Высота (без проблесковых маяков), мм

не более 4 000

Продольная база, мм

6 000

Колея передних колес, мм:

— узких

— широких

 

2 696

2 696

Колея задних колес, мм:

— узких

— широких

 

2 507

2 576

Дорожный просвет, мм:

 — под отвалом в транспортном положении

— под передним мостом

— под задним мостом

— под подвеской среднего и заднего

мостов

 

350

615

440

395

Масса автогрейдера без дополнительного оборудования, эксплуатационная, кг:

— приходящаяся на передний мост 5 660

— приходящаяся на средний и задний

мосты

 

19 680

5 660

14 020

Технические характеристики ХТ4 | Новости на сайте официального дилера Cadillac

Представлены ПРЕДВАРИТЕЛЬНЫЕ ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ CADILLAC XT4 (спецификации для Северной Америки на даты презентации модели в США 27 марта 2018)

Модель Cadillac XT4 2019
Тип кузова Компактный кроссовер премиум-класса, 5 дверей, 5 мест
Место производства Завод Fairfax Assembly, г. Канзас-сити, штат Канзас
ГАБАРИТНЫЕ РАЗМЕРЫ
Колесная база (мм) 2779
Общая длина (мм) 4599
Общая ширина (мм) 1881 (без наружных зеркал заднего вида)
Общая высота (мм) 1627 (с рейлингами)
Радиус поворота (м) 11,58
Дорожный просвет (мм) 171
ВНУТРЕННИЕ РАЗМЕРЫ И ОБЪЕМ БАГАЖНОГО ОТДЕЛЕНИЯ
Число мест для сидения (передний/задний ряд) 2 / 3
Внутренняя высота (мм) 1000 (передние сиденья) / 973 (задние сиденья)
Пространство для ног (мм) 1026 (передние сиденья)
1121 (передние сиденья, макс.)
1004 (задние сиденья)
Объем багажного отделения (куб. м.) 0,6 (за первым рядом)
1,38 (за вторым рядом)
МАССА И ТЯГОВЫЕ ХАРАКТЕРИСТИКИ
Снаряженная масса (кг) 1660 (FWD Luxury, расчетная)
Макс. тяговое усилие (кг) 1588 (с пакетом оборудования для буксировки (опция))
РАСХОД ТОПЛИВА (Предварительные данные)
Город 9,41 (л/100 км)
Трасса 7,84 (л/100 км)
Смешанный цикл 8,71 (л/100 км)
ДВИГАТЕЛЬ
Тип2,0 л, с турбонаддувом, L4 DOHC с системой Active Fuel Management (отключение цилиндров).
Диаметр цилиндра х ход поршня (мм) 83 x 92,3
Материал блока цилиндровЛитой алюминий
Материал головки блока цилиндров Литой алюминий
Газораспределительный механизм Два верхних распредвала, четыре клапана на цилиндр, система tripower
Подача топлива Прямой впрыск топлива с электронным управлением дроссельной заслонкой
Мощность ((л. с./кВт @ об/мин) 237/177 @ 5000 (сертификат SAE)
КОРОБКА ПЕРЕДАЧ
Тип Автоматическая 9-ступенчатая Hydra-Matic 9T50 с электронным управлением
ШАССИ И ПОДВЕСКА
Передняя подвеска Макферсон на стойках, с амортизатором внутри спиральной пружины, стабилизатор поперечной устойчивости непосредственного действия. Активная подвеска Active Sport Suspension с системой Continuous Damping Control (доступна в качестве опции в комплектации Sport)
Задняя подвеска Пятирычажная независимая с винтовыми пружинами и полностью изолированным подрамником
Рулевое управлениеРеечный рулевой механизм с электрическим усилителем переменного действия
Тормозная система Дисковые тормозные механизмы c ABS на всех колесах, электрогидравлический усилитель тормозов
Размер колесных дисков 18 дюймов, легкосплавные (базовая комплектация)
20 дюймов, легкосплавные (опция)

Аренда Автогрейдер ДЗ-98 в СПб и ЛО. 8 (812) 925-27-87 Звоните

  • 

Технические характеристики

Масса эксплуатационная  19800 кг 
Тип трансмиссии  механическая
Сменное рабочее оборудование Отвал бульдозерный поворотный; отвал снегоочистительный передний поворотный; рыхлитель-кирковщик заднего расположения; скарификатор передний; отвал боковой для уборки снега за ограждениями; отвал боковой для расширения зоны удаления снега с дороги, обочин
Конструктивные особенности  Импортные двигатели с низким расходом топлива. Полный привод
Высота грейдерного отвала  0,7 м
Скорость вперед  3,5-46,0 км/час
Длина грейдерного отвала  4,1 м
Число передач переднего/ заднего хода  6/ 6
Угол срезаемого откоса  90 град.
Колесная формула   1 х 3 х 3
Радиус поворота  18,0 м
Класс  250
Модель двигателя  ЯМЗ 238НД3, Cummins M-11C265
Мощность двигателя  173(202) кВт 
Габаритные размеры  11000/ 3064/ 4000 мм

Мощность двигателя: 173 кВт

Цена

Час подачи включен в стоимость смены

При оплате по б/н счет выставляется с добавлением 20% НДС

Получить рассчет стоимости

ПРОБЛЕМЫ, С КОТОРЫМИ СТАЛКИВАЮТСЯ
ПРИ АРЕНДЕ СПЕЦТЕХНИКИ
В ДРУГИХ КОМПАНИЯХ:

  1. Некачественное выполнение работ
  2. Неопытный персонал
  3. Подача техники невовремя
  4. Ненадежная техника ломается в самый нужный момент

ЧЕТЫРЕ ПРИЧИНЫ
АРЕНДОВАТЬ ТЕХНИКУ
У НАС

  1. Опыт некоторых сотрудников достигает 15 лет
  2. 70% наших клиентов пришли к нам по рекомендациям
  3. Выполняем работы качественно
  4. Вся техника не старше 5-7 лет, своевременное ТО

Наши Преимущества

Большой парк техники. Широкий спектр выполняемых работ.

10 лет — средний опыт работы наших операторов техники.

Быстрая подача техники.

Индивидуальные условия при крупных заказах.

Работаем по наличному и безналичному расчету с НДС 20%.

Гарантия лучшей цены и отсутствие скрытых платежей.

СХЕМА РАБОТЫ

Звонок менеджеру, заявка через сайт, письмо на e-mail

Обсуждение условий аренды

Заключение договора

Внесение предоплаты

Доставка техники на объект

Выполнение запланированных работ

РС830-ФКС — РЗА СИСТЕМЗ

Наименование параметра

Значение

Номинальный ток, А

5

Номинальное напряжение цепей измерения, В

100

Номинальное напряжение питания, полярность произвольная (~/=), В

220 (110)

Номинальная частота сети, Гц

50

Диапазон уставок ДЗ/МТЗ в режиме ДЗ по сопротивлению Zу при  круговой х-ке, Ом

0,1-300

Диапазоны уставок ДЗ/МТЗ  в режиме ДЗ по активному сопротивлению Rу, реактивным сопротивлениям Хун и Хук при х-ке в виде трапеции, Ом

0,1-300

Диапазон уставок пуска ДЗ по току и уставок по току при автоматическом переводе ДЗ в МТЗ

0,1-125

Диапазон уставок ДЗ/МТЗ в режиме МТЗ по току, А

0,1-125

Диапазон уставок КПМ по времени, с

0-100

Диапазон уставок ТО по току, А

0,1-125

Диапазон уставок по напряжению ЗН, В

1-150

Уставки АЧР:

-по частоте, Гц

-по скорости снижения частоты, Гц/с

 

45-51

0,1-20

Уставки ЧАПВ:

-по частоте, Гц

-по скорости повышения частоты, Гц/с

 

49-55

0,1-20

Рабочий диапазон питающего напряжения устройства, длительно ~/ =, В

80-264

Допустимое повышение питающего напряжения на время до 5 минут, В

420

Потребление по цепям питания при не срабатывании выходных реле, Вт

10

Увеличение потребления при срабатывании реле, Вт/реле

0,25

Диапазон рабочих температур, °С

от -40 до +70

Количество дискретных входов*

11/22/33/(44)

Количество выходных реле*

10/20/30/(40)

Пусковой двигатель, двигатель ПД-23, пусковой двигатель ПД

 

 

 

Полный список стран и городов, в которые осуществляется поставка запчастей: 

Т-170, т 10, т 130, т 100 (С100, Т-100), ДЗ-171, ДЗ-109 (ДЗ 109Б), б 10, б 170, б 130 (Б-130), ДЗ171 (ДЗ-171), Урал-4320, РДК-25, РДК-250, ДЭК-251, ДЭК-631, МКГ-25. 01, МКГ-25БР  Вы можете посмотреть в разделе:  ДОСТАВКА»

 

 Алиса: качество, цена на запчасти, Т-170,  Т-130, Б10, Б-10М, ДЗ-98, ДЗ98, ДТ-75, «Урал», SHANTUI, Caterpillar, KOMATSU, Hitachi, CUMMINS. SHANTUI SD16 (Шантуй СД16), Caterpillar (Катерпиллер), KOMATSU (Коматсу, Комацу), Hitachi (Хитачи), CUMMINS (Камминз), Hyundai, Volvo, Doosan, JCB, XCMG, Liugong, XGMA, Foton, BAW, FAW, YUEJIN, JAC, HOWO. Гарантия, надежность, стоимость, низкая, доставка ,быстро, купить со скидкой.


 

Оперативно доставим  транспортной  компанией  и  отдельной машиной  до склада  Покупателя, в города стран: •Республика Казахстан •Республика Беларусь •Украина •Республика Азербайджан  •Республика Кыргызстан  •Республика Армения  •Республика Таджикистан  •Грузия  •Республика Латвия•  Монголия. Запасные   части на Т 170, Т 130, Т 10, ДЗ-171:  двигатель Д-160 (б 10, б 170, б 130, Д З171),       дизель Д 180 (б 10, б 170, б 130, Д З171), пусковой П-23У (двигатель ПД-23), гусеница и цепь, отвал      (лопата, ковш, гидроотвал), рыхлитель (клык, зуб), КПП,  кабина, бортовая, на Т 170, Т 130, Б 170Б, Т 10М, Б 10МБ.  Запчастини, запчасткі, ehtiyat hissələri, кам тетиктер, պահեստամասեր, სათადარიგო ნაწილები,  rezerves daļas, қисмҳои эҳтиетӣ, қосалқы бөлшектер, сэлбэг эд анги, запас частәр,  резервни части, tartalék alkatrészek, atsarginės dalys, części zamienne, piese de schimb, делови, náhradné diely, rezervni deli, запас частьләр, yedek parça, запчастьёсын, ehtiyot qismlar, rezervni dijelovi, náhradní díly, varuosad, spare parts, Ersatzteile, 备用零件

 Доставка в н.п. РФ: Шумиха, Шадринск, Екатеринбург (202км-4ч.), Каменск-Уральский, Первоуральск, Чернушка, Кунгур, Губаха, Пермь (582км-12ч), Тюмень (1290км-28ч), Тобольск, Пыть-Ях,  Сургут (2073км-52ч.), Ханты-Мансийск (2374км-58ч.), Мегион, Стрежевой, Нижневартовск (2907км-75ч), Ноябрьск (1515км-28ч), Гупкинский, Тарко-Сале, Новый Уренгой (1935км-36ч), Надым (2160км-42ч), Ямбург.Оренбург (735км-14ч), Орск (605км-11ч), Сорочинск, Бузулук, Самара (1146км-23ч), Ульяновск (958км-19ч), Димитровград (870км-17ч), Тольятти, Сызрань, Вольск, Болаково, Саратов (1599км-38ч), Энгельс, Красноармейск, Камышин, Волжский, Волгоград (1665км-30ч), Ахтубинск, Харабали, Нариманов, Астрахань (2100км-38ч), Элиста (1968км-36ч), Ставрополь (2240км-41ч), Сочи (2630км-50ч), Краснодар (2370км-45ч), Ростов-на-Дону (2145км-40ч), Белгород (2001км-38ч), Курск (1945км-37ч), Пенза (1210км-23ч), Саранск (1823км-44ч), Тамбов (2102км-50ч),  Воронеж (2337км-56ч),  Липецк (2465км-61ч). Симферополь, Севастополь (Крым). Белорецк, Стерлитамак, Салават, Нефтекамск, Октябрьский, Уфа (379км-8ч),  Воткинск, Ижевск (777км-20ч), Набережные Челны, Альметьевск, Казань (1169км-36ч), Канаш, Чебоксары (1333км-41ч), Котельнич, Киров (1722км-52ч), Арзамас, Нижний Новгород (2284км-64ч), Ковров, Муром, Владимир (2529км-72ч), Москва и МО (2712км-77ч), Рязань (2891км-82ч), Тула (3078км-86ч),  Орел (3254км-91ч), Калуга (3458км-96ч), Тверь (3773км-108ч),  Ярославль (4072км-114ч), Кострома (4151км-117ч), Иваново (4251км-120ч), Великий Новгород, Тихвин, Луга, Вяртсиля, Санкт-Петербург. Маршрут Восток: Щучье, Курган (260км-5ч), Омск (938км-18ч), Калачинск, Татарск, Барабинск, Куйбышев, Чулым, Новосибирск (1606км-40ч), Искитим, Черепаново, Новоалтайск, Барнаул (1836км-47ч), Юрга, Томск, Кемерово (1865км-34ч), Белово, Горно-Алтайск (2072км-40ч), Новокузнецк (2005км-37ч), Абакан (2492км-45ч), Маринск, Ачинск, Дивногорск, Красноярск (2395км-44ч), Уяр, Кызыл (2870км-52ч), Тулун (3060км-56ч), Братск (3290км-60ч), Усть-Кут (3642км-66ч), Канск, Тайшет, Нижнеудинск, Зима, Черемхово, Усолье-Сибирское, Ангарск, Иркутск (3455км-64ч), Шелехов, Байкал, Байкальск, Селенгинск, Улан-Удэ (3890км-72ч), Хилок, Чита (4570км-83ч), Шилка, Нерчинск, Сковородино (5422км-100ч), Тында, Нерюнги, Алдан, Томмот, Якутск (6260км-114ч), Нижний Бестях (6235км-112ч), Магдагачи, Шимановск, Свободный, Белогорск, Благовещенск (6106км-110ч), Завитинск, Облучье, Биробиджан (6460км-115ч), Хабаровск (6630км-118ч), Хор, Вяземский, Бикин, Дальнереченск, Спасск-Дальний, Уссурийск, Артём, Владивосток (7365км-132ч).  Южно-Сахалинск. 

 

 

Отдел продаж запасных частей:

 [email protected]

Рассмотрим Ваши предложения

по сотрудничеству! 

 

Разработка и внедрение экологически чистых гидроэлектростанций: предварительное проектирование турбины Alden и испытания модели (технический отчет)

Фауст, Дж., Хекер, Г., Ли, С., и Аллен, Г. Разработка и внедрение экологически безопасных гидроэнергетических турбин: предварительное проектирование и испытания модели турбины Олдена . США: Н. п., 2011. Интернет. DOI: 10,2172 / 1050066.

Фуст, Дж., Хеккер, Г., Ли, С., и Аллен, Г. Разработка и внедрение экологически безопасных гидроэнергетических турбин: предварительное проектирование и испытания модели турбины Олдена . Соединенные Штаты. https://doi.org/10.2172/1050066

Foust, J., Hecker, G., Li, S., and Allen, G. Sat. «Разработка и внедрение экологически чистых гидроэнергетических турбин: предварительное проектирование и испытания модели Alden Turbine».Соединенные Штаты. https://doi.org/10.2172/1050066. https://www.osti.gov/servlets/purl/1050066.

@article {osti_1050066,
title = {Разработка и внедрение экологически безопасных гидроэнергетических турбин: предварительное проектирование и испытания модели Alden Turbine},
author = {Фуст, Дж., Хеккер, Г., Ли, С. и Аллен, Г.},
abstractNote = {Турбина Олдена была разработана U.S. Бывшая программа передовых гидротурбинных систем Министерства энергетики (DOE) (1994-2006), а в последнее время - через Институт исследований в области электроэнергетики (EPRI) и Программу ветро- и гидроэнергетики Министерства энергетики США. Основная цель описанного здесь инженерного исследования состояла в том, чтобы предоставить коммерчески конкурентоспособную конструкцию турбины, которая обеспечила бы выживаемость рыбы при пролете, сравнимую или превышающую выживаемость при обходе или разливе потока. Хотя конструкция турбины была выполнена для условий площадки, соответствующих чистому напору 92 футов (28 м) и расходу 1500 кубических футов в секунду (42.5 см), конструкция может быть изменена для дополнительных площадок с различными условиями эксплуатации. Во время разработки турбины были внесены изменения в конструкцию спирального корпуса, распределителя (упорные лопатки и калитки), рабочего колеса и отсасывающей трубы для улучшения характеристик турбины при сохранении характеристик, обеспечивающих высокую выживаемость прохода рыбы. Результаты расчета скоростей изменения давления и сдвига в проходе рабочего колеса были аналогичными для исходной и конечной геометрий турбины, в то время как прогнозируемые минимальные давления были выше для последней турбины. Ожидается, что окончательная геометрия турбины и результирующая среда потока дополнительно улучшат характеристики прохождения рыбы в турбине. Результаты расчетов для окончательного проекта показали, что КПД турбины повысился более чем на 6% в выбранных условиях эксплуатации по сравнению с исходной концепцией. Перед выпуском гидравлических компонентов для изготовления модели были проведены расчеты методом конечных элементов для упорных лопаток, ворот калитки и рабочего колеса, чтобы убедиться, что критерии проектирования конструкции для напряжений и прогибов были выполнены.Физическая модель турбины была изготовлена ​​и испытана с использованием собранных данных о мощности и КПД, пределах кавитации, скорости разгона, осевой и радиальной осевой нагрузке, пульсации давления и крутящем моменте калитки. Было замечено, что все параметры находятся в пределах ожидаемых для обычных машин с радиальным потоком. На основе этих измерений ожидаемый пик эффективности для прототипа составляет 93,64%. Эти данные были использованы в окончательной проклейке опорного механического и баланса заводского оборудования. Предварительная стоимость оборудования по проектной документации составляет 1450 долларов США / кВт при общем графике поставки 28 месяцев. Поставка оборудования включает турбину, генератор, средства управления агрегатом, ограниченный баланс заводского оборудования, монтаж на месте и ввод в эксплуатацию. Основываясь на выбранных расчетных условиях напора и потока, выживаемость при прохождении рыбы через последнюю турбину оценивается примерно в 98% для рыбы диаметром 7,9 дюйма (200 мм), а прогнозируемая выживаемость достигает 100% для рыбы размером 3,9 дюйма (100 мм). и меньше по длине.Обратите внимание, что рыба длиной до 7,9 дюймов (200 мм) составляет более 90% рыбы, уловленной на гидроэлектростанциях в США. Завершение этих усилий обеспечивает механическую и электрическую конструкцию, которая может быть легко адаптирована к условиям конкретной площадки с дополнительными инженерными разработками, сопоставимыми с затратами, связанными с традиционными конструкциями турбин.},
doi = {10. 2172 / 1050066},
url = {https://www.osti.gov/biblio/1050066}, журнал = {},
номер =,
объем =,
place = {United States},
год = {2011},
месяц = ​​{10}
}

% PDF-1.7 % 6318 0 объект > endobj xref 6318 190 0000000016 00000 н. 0000007169 00000 н. 0000007364 00000 н. 0000007402 00000 н. 0000008479 00000 п. 0000008517 00000 н. 0000008656 00000 н. 0000008797 00000 н. 0000009153 00000 п. 0000009561 00000 н. 0000009886 00000 н. 0000010612 00000 п. 0000011383 00000 п. 0000011546 00000 п. 0000011893 00000 п. 0000012220 00000 п. 0000012333 00000 п. 0000012553 00000 п. 0000013308 00000 п. 0000013648 00000 п. 0000014126 00000 п. 0000014165 00000 п. 0000014280 00000 п. 0000017567 00000 п. 0000017914 00000 п. 0000018229 00000 п. 0000018880 00000 п. 0000019164 00000 п. 0000019279 00000 п. 0000019392 00000 п. 0000020012 00000 н. 0000020681 00000 п. 0000023600 00000 п. 0000025313 00000 п. 0000027988 00000 н. 0000030888 00000 п. 0000033672 00000 п. 0000036338 00000 п. 0000036754 00000 п. 0000038576 00000 п. 0000040945 00000 п. 0000041035 00000 п. 0000041433 00000 п. 0000041731 00000 п. 0000042053 00000 п. 0000042319 00000 п. 0000042651 00000 п. 0000043008 00000 п. 0000045161 00000 п. 0000047397 00000 п. 0000053145 00000 п. 0000054748 00000 п. 0000061437 00000 п. 0000064087 00000 п. 0000065207 00000 п. 0000065631 00000 п. 0000065654 00000 п. 0000065677 00000 п. 0000065753 00000 п. 0000066046 00000 п. 0000066456 00000 п. 0000066532 00000 п. 0000066720 00000 п. 0000067129 00000 п. 0000067205 00000 п. 0000067389 00000 п. 0000067796 00000 п. 0000067872 00000 п. 0000068160 00000 п. 0000068594 00000 п. 0000068670 00000 п. 0000068874 00000 п. 0000069287 00000 п. 0000069363 00000 п. 0000069609 00000 п. 0000070061 00000 п. 0000070137 00000 п. 0000070474 00000 п. 0000070952 00000 п. 0000071028 00000 п. 0000071278 00000 п. 0000071703 00000 п. 0000071779 00000 п. 0000071985 00000 п. 0000072397 00000 п. 0000072473 00000 п. 0000072681 00000 п. 0000073097 00000 п. 0000073173 00000 п. 0000073405 00000 п. 0000073812 00000 п. 0000073888 00000 п. 0000074204 00000 п. 0000074453 00000 п. 0000075071 00000 п. 0000075147 00000 п. 0000075393 00000 п. 0000075813 00000 п. 0000075889 00000 п. 0000076103 00000 п. 0000076543 00000 п. 0000076619 00000 п. 0000076865 00000 п. 0000077276 00000 п. 0000077352 00000 п. 0000077638 00000 п. 0000078058 00000 п. 0000078134 00000 п. 0000078440 00000 п. 0000078862 00000 п. 0000078938 00000 п. 0000079160 00000 п. 0000079572 00000 п. 0000079648 00000 н. 0000079724 00000 п. 0000080039 00000 п. 0000080459 00000 п. 0000080780 00000 п. 0000080856 00000 п. 0000080932 00000 п. 0000081116 00000 п. 0000081532 00000 п. 0000081853 00000 п. 0000081929 00000 п. 0000082005 00000 п. 0000082255 00000 п. 0000082682 00000 п. 0000083005 00000 п. 0000083081 00000 п. 0000083364 00000 н. 0000083772 00000 п. 0000083848 00000 п. 0000083924 00000 п. 0000084088 00000 п. 0000084501 00000 п. 0000084577 00000 п. 0000084775 00000 п. 0000085192 00000 п. 0000085525 00000 п. 0000085601 00000 п. 0000085677 00000 п. 0000085929 00000 п. 0000086356 00000 п. 0000086677 00000 п. 0000086753 00000 п. 0000086829 00000 п. 0000087016 00000 п. 0000087431 00000 п. 0000087751 00000 п. 0000087827 00000 п. 0000087903 00000 п. 0000088153 00000 п. 0000088580 00000 п. 0000088903 00000 п. 0000088979 00000 н. 0000089055 00000 п. 0000089219 00000 п. 0000089634 00000 п. 0000089710 00000 п. 0000089908 00000 н. 00000

  • 00000 п. 00000 00000 п. 00000 00000 п. 00000 00000 п. 00000 00000 н. 00000 00000 п. 00000 00000 п. 00000 00000 п. 00000 00000 п. 00000 00000 п. 00000

    00000 п. 00000 00000 п. ​​Bp! v _ (* T4 «HѶhj`JbLK + j ۄ, t4iu ݎ vgk s = w ~ s

    Программно-управляемая облачная сеть — Arista

    Программно-управляемая облачная сеть — Arista

    Прожектор

    Многодоменная сегментация Arista

    Новости


    Arista обеспечивает многодоменную сегментацию для предприятия с нулевым доверием

    Читать больше

    Arista Networks объявит финансовые результаты за 4 квартал и 2020 финансовый год в четверг, 18 февраля 2021 года

    Читать больше

    Arista представляет сервис оценки поверхности атаки

    Читать больше Икс

    Arista Networks, Inc. использует файлы cookie, чтобы обеспечить вам лучший опыт на нашем веб-сайте.

    Продолжая использовать наш сайт, вы даете согласие на получение файлов cookie с нашего сайта. Подробную информацию об использовании файлов cookie Arista можно найти здесь.

    Определение архитектуры и ранней эволюции преддугового бассейна (бассейн Джорджии, Канада) с использованием детритового циркона

  • 1.

    Горчица, П. С. Верхнемеловая группа Нанаймо, бассейн Джорджии. Геология и геологические опасности региона Ванкувер, юго-запад Британской Колумбии.Отредактировал JWH Monger. Геологическая служба Канады, Бюллетень 481 , 27–95 (1994).

  • 2.

    Аксой, Э., Тюркмен, И. И Туран М. Тектоника и седиментация в конвергентных краевых бассейнах: пример третичного бассейна Элазыг, Восточная Турция. J. Asian Earth Sci. 25 , 459–472, https://doi.org/10.1016/j.jseaes.2004.04.009 (2005).

    ADS Статья Google ученый

  • 3.

    Маккаррон, Дж. Дж. Объединяющая литостратиграфия позднемеловых — раннетретичных вулканических последовательностей преддуговых дуг на острове Александр в Антарктиде. Антарктида. Sci. 9 , 209–220, https://doi.org/10.1017/S020266 (1997).

    ADS Статья Google ученый

  • 4.

    Takashima, R. et al. . Геология и стратиграфия отложений преддугового бассейна на Хоккайдо, Япония: экологические события мелового периода на северо-западной окраине Тихого океана. Cretaceous Res. 25 , 365–390, https://doi.org/10. 1016/j.cretres.2004.02.004 (2004).

    Артикул Google ученый

  • 5.

    Кавуд, П. А., Хоксворт, К. Дж. И Дуайм, Б. Запись детритового циркона и тектоническая обстановка. Геология 40 , 875–878, https://doi.org/10.1130/G32945.1 (2012).

    ADS Статья Google ученый

  • 6.

    Дикинсон, У. Р. и Герелс, Г. Е. Использование U-Pb возраста обломочных цирконов для определения максимального возраста отложений пластов: тест на основе мезозойской базы данных плато Колорадо. Планета Земля. Sci. Lett. 288 , 115–125, https://doi.org/10.1016/j.epsl.2009.09.013 (2009).

    ADS CAS Статья Google ученый

  • 8.

    Daniels, B.G. et al. . Сроки развития глубоководного склона, ограниченные геохронологией крупно-детритовых отложений и вулканических пеплов, меловой бассейн Магалланес, Чили. Бюллетень GSA 130 , 438–454, https://doi.org/10.1130/B31757.1 (2018).

    CAS Статья Google ученый

  • 9.

    Бернхардт А., Джобе З. Р. , Гровен М. и Лоу Д. Р. Палеогеография и диахронное заполнение древнего глубоководного форландского бассейна, верхнемеловая формация Серро-Торо, бассейн Магланес. Basin Res. 24 , 269–294, https://doi.org/10.1111/j.1365-2117.2011.00528.x (2011).

    ADS Статья Google ученый

  • 10.

    Малковски М.А., Джобе З.Р., Шарман Г.Р. и Грэм С.А. Изменчивость фациальной изменчивости нисходящих склонов в системах глубоководных каналов: выводы из верхнемеловой формации Серро-Торо, южная Патагония. Седиментология 65 , https://doi.org/10.1111/sed.12452 (2019).

    Артикул Google ученый

  • 11.

    Зикманн, З. Т., Шварц, Т. М. и Грэм, С. А. Уточнение стратиграфии и тектонической истории с использованием максимального возраста осадконакопления циркона: пример из формации Серро Форталеза, бассейн Аустрал, южная Патагония. Бассейн Res . 30 , https://doi.org/10.1111/bre.12272 (2017).

    ADS Статья Google ученый

  • 12.

    Matthews, WA, Guest, B., Coutts, D., Bain, HA & Hubbard, SM Детритные цирконы из бассейна Нанаймо, остров Ванкувер, Британская Колумбия: независимый тест от позднего мела до кайнозоя, северный перевод . Тектоника 36 , 854–876, https://doi.org/10.1002/2017TC004531 (2017).

    ADS Статья Google ученый

  • 13.

    Фридман Р. М. и Армстронг Р. Л. В юрском магматизме и тектонике Североамериканских Кордильер Vol. 299 (ред. Миллер Д.М. и Басби К.) 95–139 (Специальный доклад Геологического общества Америки, 1995 г.).

  • 15.

    Махони, Дж. Б. и др. . Цирконы архея в толще меловых отложений западных канадских Кордильер: Гипотеза «Baja BC» не проходит «решающую проверку». Геология 27 , 195–198 (1999). 10.1130 / 0091-7613 (1999) 027 <0195: AZICSO> 2.3.CO; 2.

    ADS Статья Google ученый

  • 16.

    Мастард П. С., Пэрриш Р. Р. и МакНиколл В. Происхождение группы нанаймо верхнего мела, Британская Колумбия: данные U-Pb анализов обломочных цирконов. Стратиграфическая эволюция форландских бассейнов, Специальная публикация SEPM 52 , 65–76, https://doi.org/10.2110/pec.95.52.0065 (1995).

    Артикул Google ученый

  • 17.

    Пахт, Дж. А. Петрологическая эволюция и палеогеография позднемелового бассейна Нанаймо, Вашингтон и Британская Колумбия: значение для тектоники мелового периода. Геол. Soc. Am. Бык . 95 , 766–778, 10.1130 / 0016-7606 (1984) 95 <766: PEAPOT> 2.0.CO; 2 (1984).

    ADS Статья Google ученый

  • 18.

    Уорд П. Д. и Стэнли К. О. Формация Хаслам: месторождение преддугового бассейна позднего сантона-раннего кампана в островном поясе на юго-западе Британской Колумбии и прилегающем Вашингтоне. J. Осадок. Res. 52 , 975–990, https: // doi.org / 10.1306 / 212F80A3-2B24-11D7-8648000102C1865D (1982).

    Артикул Google ученый

  • 19.

    Vermeesch, P. Многовыборочное сравнение возрастных распределений обломков. Chem. Геол. 341 , 140–146, https://doi.org/10.1016/j.chemgeo.2013.01.010 (2013).

    ADS CAS Статья Google ученый

  • 20.

    England, T. D. J. & Bustin, R.М. Архитектура бассейна Джорджии на юго-западе Британской Колумбии. Бык. Мочь. Домашнее животное. Геол. 46 , 288–320 (1998).

    Google ученый

  • 21.

    Хаггарт, Дж. У., Уорд, П. Д. и Орр, В. Туронская (верхний мел) литостратиграфия и биохронология, южные острова Персидского залива, Британская Колумбия, и северные острова Сан-Хуан, штат Вашингтон. банка. J. Earth Sci. 42 , 2001–2020, https: // doi.org / 10.1139 / e05-066 (2005).

    ADS Статья Google ученый

  • 22.

    Хамблин, А. П. Верхнемеловая группа Нанаймо острова Ванкувер как потенциальная зона подземного водоносного горизонта: обзор предшествующей литературы и концепций. Геол. Surv. Можно открыть файл 7265 , 20, https://doi.org/10.4095/2 (2012).

    Артикул Google ученый

  • 23.

    Мюллер, Дж. Э. и Джелецки, Дж. А. Геология верхнего мела группы Нанаймо, остров Ванкувер и острова Персидского залива, Британская Колумбия. (Геологическая служба Канады; Министерство энергетики, шахт и ресурсов, 1970).

  • 24.

    Уорд П. Д. Изменения в стратиграфии и биохронологии верхней группы нанаймо верхнего мела, Британская Колумбия и штат Вашингтон. банка. J. Earth Sci. 15 , 405–423 (1978).

    ADS Статья Google ученый

  • 25.

    Бикфорд, К.Г.К. и Кеньон, К. Геология угольного месторождения восточной части острова Ванкувер. Министерство энергетики, горнодобывающей промышленности и нефтяных ресурсов Британской Колумбии, Геологические полевые работы 1988-1 , 441–450 (1988).

  • 26.

    Англия, Т. Д. Дж. Эволюция от позднего мела до палеогена в бассейне Джорджии, Юго-западная Британская Колумбия. Докторская диссертация, Мемориальный университет (1989).

  • 27.

    Кент, Б. А. П., Хуанг, К., Даштгард, С. Э. и Кэтил-Хун, Г.Зарождение и ранняя эволюция преддугового бассейна: бассейн Джорджии, Канада. Basin Res. Early View , 23 , https://doi.org/10.1111/bre.12378 (2019).

  • 28.

    ДеБари, С. М., Андерсон, Р. Г. и Мортенсен, Дж. К. Корреляция между нижними и верхними компонентами земной коры в островной дуге: юрская дуга Бонанца, остров Ванкувер, Канада. банка. J. Earth Sci. 36 , 1371–1413 (1999).

    ADS CAS Статья Google ученый

  • 29.

    Isachsen, C.E. Геология, геохимия и история похолодания кристаллического комплекса Западного побережья и связанных с ним горных пород, острова Мерес и его окрестностей, остров Ванкувер, Британская Колумбия. банка. J. Earth Sci. 24 , 2047–2064 (1987).

    ADS CAS Статья Google ученый

  • 30.

    Канил Д., Джонстон С. Т., Ларок Дж., Фридман Р. М. и Химан Л. М. Возраст, конструкция и эксгумация средней корки юрской дуги Бонанза, остров Ванкувер, Канада. Литосфера 5 , 82–91 (2012).

    ADS Статья Google ученый

  • 31.

    Рукс, Т. В. Стратиграфия и палеотектонические исследования палеозойской Врангеллии и содержащих вулканогенные массивные сульфидные образования (VMS), остров Ванкувер, Британская Колумбия, Канада, докторская диссертация, , Университет Британской Колумбии, (2015).

  • 33.

    Герельс, Г. Э. Геологическая карта южной части острова Принца Уэльского, Юго-восточная Аляска . (1992).

  • 34.

    Герельс, Г.Э. и Салиби, Дж. Б. Геологическая структура, тектоническая эволюция и история смещения Александровского террейна. Тектоника 6 , 151–173 (1987).

    ADS Статья Google ученый

  • 36.

    Спенсер, К. Дж., Киркланд, К. Л. и Робертс, Н. М. У. Влияние эрозии и состава коренных пород на плодородие циркона: примеры из Южной Америки и Западной Австралии. Terra Nova 30 , 289–295, https://doi.org/10.1111/ter.12338 (2018).

    ADS CAS Статья Google ученый

  • 37.

    Хэмпсон, Г.Дж., Даллер, Р.А., Петтер, А.Л., Робинсон, Р.Дж. и Аллен, П. А. Ограничения массового баланса на стратиграфическую интерпретацию связанных аллювиально-прибрежно-шельфовых отложений от источника до стока: пример из мелового Западного внутреннего бассейна, Юта и Колорадо , СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. J. Осадок. Res. 84 , 935–960 (2014).

    ADS Статья Google ученый

  • 38.

    Гринвуд, Х. Дж. И Михалинюк, М.G. Открытый файл 2009-2011 (Министерство энергетики, горнодобывающей промышленности и нефтяных ресурсов Британской Колумбии, 2009 г.).

  • 39.

    Coutts, D. S., Matthews, W. A. ​​и Hubbard, S. M. Оценка широко используемых методов определения возраста отложений по популяциям обломочного циркона. Geoscience Frontiers 10 , 1421–1435, https://doi.org/10.1016/j. gsf.2018.11.002 (2019).

    CAS Статья Google ученый

  • 40.

    Джонстон, С. А., Шварц, Т. М., Холм-Денома, С. С. Стратиграфический подход к выводу возраста осадконакопления на основе данных детритовой геохронологии. Frontiers in Earth Science 5 , 19, https://doi.org/10.3389/feart.2019.00057 (2019).

    Артикул Google ученый

  • 41.

    Рамирес, С. Г., Гулик, С. П. и Хейман, Н. В. Ранняя седиментация и деформация в преддуговом бассейне Кумано, связанные с эволюцией Нанкайской аккреционной призмы, юго-запад Японии. Geochem. Geophys. Геосист. 16 , 1616–1633, https://doi.org/10.1002/2014GC005643 (2015).

    ADS Статья Google ученый

  • 43.

    Джонс, М. Т., Даштгард, С. Э. и Макихерн, Дж. А. Модель сохранения мощных трансгрессивных последовательностей береговой линии: примеры из преддуги бассейна Нанаймо, Британская Колумбия, Канада. J. Осадок. Res. 88 , 811–826, https://doi.org/10.2110/jsr.2018.40 (2018).

    ADS CAS Статья Google ученый

  • 44.

    Пейс, Дж. Б. и Миллер, Дж. Д. Точные U-Pb-возрасты комплекса Дулут и связанных с ним основных интрузий, северо-восток Миннесоты: геохронологические исследования физических, петрогенетических, палеомагнитных и тектономагматических процессов, связанных с рифтовой системой Мидконтинента 1,1 млрд. J. Geophys. Res . 98 (1993).

  • 45.

    Шмитц, М. Д. и Боуринг, С. А. Систематика U-Pb циркона и титанита туфа Рыбного каньона: оценка высокоточной геохронологии U-Pb и ее применение к молодым вулканическим породам. Геохим. Cosmochim. Acta 65 , 2571–2587, https://doi.org/10.1016/S0016-7037(01)00616-0 (2001).

    ADS CAS Статья Google ученый

  • 46.

    Маттинсон, Дж. М. Анализ относительных констант распада 235 U и 238 U путем многоступенчатых измерений CA-TIMS образцов природного циркона замкнутой системы. Chem. Геол. 275 , 186–198, https://doi.org/10.1016/j.chemgeo.2010.05.007 (2010).

    ADS CAS Статья Google ученый

  • 48.

    Патрон, К. и др. . Улучшенная лазерная абляция геохронологии U-Pb циркона за счет надежной коррекции фракционирования в скважине. Геохимия Геофизика Геосистемы 11 , 36 (2010).

    Google ученый

  • 49.

    Петрус, Дж. А. и Камбер, Б. С. VizualAge: новый подход к обработке данных геохронологии методом лазерной абляции ICP-MS U-Pb. Геостандарт. Геоанал. Res. 36 , 247–270 (2012).

    CAS Статья Google ученый

  • 50.

    Matthews, W. A. ​​& Guest, B. Практический подход к сбору массивов данных об U-Pb обломочного циркона с большим n с помощью квадрупольного LA-ICP-MS. Геостандарт. Геоанал. Res. 41 , 161–180, https: // doi.org / 10.1111 / ggr.12146 (2017).

    CAS Статья Google ученый

  • 51.

    Герелс Г. Э. В палеозойской и триасовой палеогеографии и тектонике Западной Невады и Северной Калифорнии Vol. 347 (ред. М. Сореган и Джордж Э. Герелс) 18 (Специальная статья — Геологическое общество Америки, 2000 г.).

  • 52.

    Клепейс, К. А., Кроуфорд, М. Л. и Герелс, Г. Э. Структурная история прибрежной зоны сдвига земной коры к северу от Портлендского канала, юго-востоке Аляски и Британской Колумбии. J. Struct. Геол. 20 , 883–904, https://doi.org/10.1016/S0191-8141(98)00020-0 (1998).

    ADS Статья Google ученый

  • 53.

    Хорствуд, М.С.А. и др. . Разработанные сообществом стандарты для геохронологии LA-ICP-MS (U-Th-) Pb — распространение неопределенности, интерпретация возраста и представление данных. Геостандарт. Геоанал. Res. 40 , 311–332, https://doi.org/10.1111/j.1751-908X.2016.00379.x (2016).

    CAS Статья Google ученый

  • 54.

    Блэк, Л. П. и др. . Применение SHRIMP в фанерозойской геохронологии; критическая оценка четырех стандартов циркона. Chem. Геол. 200 , 171–188, https://doi.org/10.1016/S0009-2541(03)00166-9 (2003).

    ADS CAS Статья Google ученый

  • 55.

    Стерн, Р. А., Бодоркос, С., Камо, С. Л., Хикман, А. Х. и Корфу, Ф. Измерение инструментального массового фракционирования изотопов Pb методом SIMS при датировании циркона. Геостандарт. Геоанал. Res. 33 , 145–168, https://doi.org/10.1111/j.1751-908X.2009.00023.x (2009).

    CAS Статья Google ученый

  • 56.

    Pecha, M. & Gehrels, G.E. Геохронология U-Pb детритового циркона и геохимия изотопов Hf палеозойских и триасовых пассивных окраинных пластов западной части Северной Америки. Геосфера 10 , 49–65, https://doi.org/10. 1130/GES00889.1 (2014).

    Артикул Google ученый

  • 57.

    Герельс, Г. Э., Валенсия, В. А. и Руис, Дж. Повышение точности, точности, эффективности и пространственного разрешения U-Pb возрастов с помощью масс-спектрометрии с лазерной абляцией, мультиколлектором и индуктивно связанной плазмой. Geochemistry Geophysics Geosystems 9 , 13, https://doi.org/10.1029/2007GC001805 (2008).

    CAS Статья Google ученый

  • 58.

    Vermeesch, P. О визуализации возрастного распределения обломков. Chem. Геол. 312–313 , 190–194, https://doi.org/10.1016/j.chemgeo.2012.04.021 (2012).

    CAS Статья Google ученый

  • 60.

    Шарман, Г. Р., Шарман, Дж. П. и Сильвестр, З. detritalPy: набор инструментов на основе Python для визуализации и анализа геотермохронологических данных обломков. Записи об осаждении 4 , 202–215, https://doi.org/10.1002/dep2.45 (2018).

    Артикул Google ученый

  • MiR-23 ~ 27 ~ 24-опосредованный контроль гуморального иммунитета выявляет регулирующий контур, управляемый TOX, в дифференцировке фолликулярных Т-хелперных Т-клеток иммунитет.На сегодняшний день микроРНК (miRNAs) стали важными игроками в регуляции клеточной биологии T

    FH . Здесь мы показываем, что потеря miR-23 ~ 27 ~ 24 кластеров в Т-клетках приводила к увеличению частоты клеток T FH при различных иммунных проблемах, тогда как избыточная экспрессия этого семейства miRNA приводила к снижению клеточных ответов T FH . Механически кластеры miR-23 ~ 27 ~ 24 координируют контроль клеток T FH посредством нацеливания на сеть генов, которые имеют решающее значение для биологии клеток T FH .Среди них белок HMG-box (TOX), связанный с отбором тимоцитов, был идентифицирован как центральный регулятор транскрипции в развитии клеток T FH . В клетках T FH мыши и человека уровень TOX сильно повышается BCL6-зависимым образом. В свою очередь, TOX способствует экспрессии множества молекул, которые играют критическую роль в дифференцировке и функционировании клеток T FH . В совокупности наши результаты устанавливают ключевой регулон miRNA, который поддерживает оптимальные клеточные ответы T FH для результирующего гуморального иммунитета.

    ВВЕДЕНИЕ

    За последнее десятилетие специализированная подгруппа Т-клеток, известная как фолликулярные хелперные Т-клетки (T FH ), подвергалась тщательному изучению на предмет их решающей роли в помощи В-клеткам в создании эффективных гуморальных иммунных ответов ( 1 , 2 ). Внутри фолликулов B-клеток взаимодействие между T FH и B-клетками через множество различных пар рецептор / лиганд приводит к образованию зародышевого центра (GC) и последующему образованию плазматических клеток, продуцирующих высокоаффинные антитела (Ab). и долгоживущие В-клетки памяти.Дефекты дифференцировки или функции клеток T FH могут серьезно нарушить или даже полностью отменить ответы GC, что приведет к потере защитного гуморального иммунитета против вредных патогенов. С другой стороны, аберрантные реакции GC, вызванные дисрегулируемыми клеточными ответами T FH , также могут привести к развитию многих аутоиммунных заболеваний. Следовательно, лучшее понимание молекулярных механизмов, которые управляют дифференцировкой и функцией клеток T FH , чрезвычайно важно для здоровья человека, так что могут быть разработаны более эффективные стратегии для индукции более сильных иммунных ответов против инфекции и ослабления нежелательного аутоиммунитета посредством нацеливания на этот специфический Подмножество Т-клеток.

    Открытие B-клеточной лимфомы 6 (BCL6) в качестве главного регулятора транскрипции для дифференцировки клеток T FH дало ключ к изучению сложной биологии этой клеточной популяции ( 3 5 ). Экспрессия BCL6 индуцируется и поддерживается в Т-клетках, получающих последовательные сигналы индуцибельного Т-клеточного костимулятора (ICOS) посредством взаимодействия с дендритными и В-клетками ( 6 ). После индукции BCL6 обеспечивает развитие клеток T FH посредством противодействия дифференцировке других линий хелперных Т-клеток, одновременно инструктируя клетки T FH для экспрессии соответствующих хемотаксических рецепторов, позволяющих им мигрировать в фолликулы B-клеток и GC ( 7 ).Хотя BCL6 необходим для поддержания экспрессии CXCR5, определяющей особенности клеток T FH , было показано, что начальная повышающая регуляция CXCR5 в клетках T FH не зависит от BCL6 и что комплекс achaete-scute подобен 2 ( ASCL2), основной транскрипционный фактор спираль-петля-спираль, необходим для стимулирования экспрессии CXCR5 ( 8 ). Точно так же продукция интерлейкина-21 (IL-21), ключевого цитокина, секретируемого клетками T FH , важного как для образования GC, так и для собственно развития клеток T FH , управляется другим фактором транскрипции, индуцирующим ICOS, c- MAF ( 9 , 10 ).Подобно ASCL2 и c-MAF, недавно было показано, что многие другие факторы транскрипции играют важную роль в регуляции различных аспектов клеточной биологии T FH ( 2 ). Вместе эти исследования демонстрируют сложную природу процессов дифференцировки клеток T FH и предполагают, что клетки T FH согласованно контролируются множеством факторов транскрипции.

    Помимо регуляции транскрипции, сейчас хорошо известно, что развитие и эффекторные функции иммунной системы также регулируются посттранскрипционно, особенно с помощью класса коротких регуляторных некодирующих РНК, так называемых микроРНК (miRNAs) ( 11 ).На сегодняшний день изучено несколько miRNAs на предмет их роли в стимулировании или ограничении клеточных ответов T FH ( 12 ). Ранее мы идентифицировали miR-23 ~ 27 ~ 24 кластера как основное семейство miRNA, регулирующее Т-клеточный иммунитет ( 13 15 ). Однако их роль в контроле клеточных ответов T FH еще предстоит определить. Здесь, используя подходы потери функции и увеличения функции, мы показываем, что потеря кластеров miR-23 ~ 27 ~ 24 в Т-клетках приводит к повышенным частотам T FH и GC B-клеток при различных иммунологических условиях. проблем, тогда как Т-клеточно-специфическая сверхэкспрессия этого семейства miRNA ведет к снижению клеточных ответов T FH .Механически члены семейства miR-23 ~ 27 ~ 24 кооперативно репрессируют как известные [например, фактор Т-клеток 1 (TCF1) ( 15 17 ) и c-REL ( 9 , 14 )) а также ранее не охарактеризованные мишени [например, c-MAF, ICOS и IL-21 ( 9 )], которые играют критическую роль в управлении множеством аспектов биологии T FH . Более того, мы демонстрируем, что недавно идентифицированная мишень miR-23 ~ 27 ~ 24, белок HMG-box, связанный с селекцией тимоцитов (TOX), функционирует как центральный регулятор транскрипции в клетках T FH . Эктопическая экспрессия ТОХ в Т-клетках увеличивала количество клеток Т FH , в то время как снижение ТОХ нарушало клеточные ответы Т FH . Повышенная экспрессия TOX в клетках T FH управляется BCL6 как у мыши, так и у человека. В свою очередь, TOX был способен стимулировать экспрессию множества молекул, включая TCF1, фактор связывания лимфоидного энхансера 1 (LEF1) и белок запрограммированной гибели клеток 1 (PD1), которые имеют решающее значение для биологии клеток T FH . Вместе наши результаты устанавливают ключевой регулон miRNA, который обеспечивает оптимальные клеточные ответы T FH для результирующего гуморального иммунитета.Более того, наше исследование опосредованной miR-23 ~ 27 ~ 24 регуляции генов позволяет нам найти нового молекулярного игрока, TOX, в контроле дифференцировки и функции клеток T FH .

    РЕЗУЛЬТАТЫ

    Повышенные гуморальные иммунные ответы у мышей с Т-клеточной делецией семейства miR-23 ~ 27 ~ 24

    Недавно мы и другие продемонстрировали, что семейство miR-23 ~ 27 ~ 24 (включая оба miR -23a ~ 27a ~ 24-2 и miR-23b ~ 27b ~ 24-1 кластеры) ограничивает ответы Т-хелпера 2 (T H 2) во время аллергической реакции дыхательных путей ( 13 , 18 ). В дополнение к повышенной выработке аллергенного иммуноглобулина E (IgE), как сообщалось ранее, при индукции астмы мы также могли обнаруживать повышенные уровни общего сывороточного IgG и наблюдали значительно больше и больше GC с повышенным количеством инфильтрирующих клеток T FH в селезенке. мышей с Т-клеточной делецией miR-23 ~ 27 ~ 24 кластеров (T-DKO) (рис. S1, A и B). В соответствии с этими данными, аллерген-сенсибилизированные мыши T-DKO имели значительно увеличенные частоты и количества как клеток T FH , так и клеток GC B, что позволяет предположить, что семейство miR-23 ~ 27 ~ 24 также может играть важную роль в регуляции T FH клеточные ответы и результирующий гуморальный иммунитет (рис.S1, C и D). Чтобы дополнительно изучить эту возможность, мы попытались изучить клетки T FH на мышах в контексте острой инфекции вирусом лимфоцитарного хориоменингита (LCMV). Было хорошо установлено, что после заражения LCMV у мышей развиваются сильные LCMV-специфические клеточные ответы T FH и что дефекты частот клеток T FH приводят к неспособности контролировать этот патоген ( 3 , 19 ). В то время как мыши T-DKO, по-видимому, содержали нормальное количество T , FH и GC B-клеток в отсутствие какой-либо иммунной нагрузки в молодом возрасте, аналогично тому, что мы показали при астматическом состоянии, после инфекции LCMV общее количество и LCMV-специфическое Ответы клеток T FH , наряду с явным увеличением частоты и количества GC B-клеток, были легко обнаружены у мышей T-DKO (рис.1, А и В, и рис. S2). Подтверждая эти результаты, мы также обнаружили повышенные ответы GC с увеличением количества инфильтрирующих клеток T FH в селезенке мышей T-DKO, инфицированных LCMV (рис. 1C). Следовательно, мыши T-DKO продуцировали значительно большее количество LCMV-специфических Abs по сравнению с их однопометниками дикого типа (WT) при инфицировании LCMV (фиг. 1D и фиг. S3). Следует отметить, что семейство miR-23 ~ 27 ~ 24 регулирует клеточные ответы T FH не только внутренним образом T-клеток, но также внутренним образом T FH . С этой целью в Т-клетках, лишенных кластеров miR-23 ~ 27 ~ 24, у химерных мышей смешанного костного мозга (BM), где BM клетки от мышей T-DKO или однопометников WT смешивали с клетками ВМ от мышей с конгенированной меткой Ly5.1 + B6 в соотношении 1: 1 с облученными мышами с дефицитом Rag1 (фиг. S4). Кроме того, подтверждая внутреннюю роль клеток T FH кластеров miR-23 ~ 27 ~ 24 в контроле клеточных ответов T FH , мы обнаружили повышенную экспрессию всего семейства miR-23 ~ 27 ~ 24 в T FH клетки, аналогичные тому, что было сообщено о miR-146a, другой miRNA, которая сильно активируется в клетках T FH , чтобы ограничить их ответы (рис.S5) ( 20 ). Наконец, результаты нашего исследования смешанных BM-химер также показали, что аберрантные ответы клеток T FH и GC B, наблюдаемые у мышей T-DKO, не являются результатом нарушения регуляции иммунной регуляции, опосредованной регуляторными T (T reg ), хотя роль семейства miR-23 ~ 27 ~ 24 в клетках T reg уже упоминалась ранее ( 13 , 14 ). Последовательно, инфицированные LCMV мыши с клеточно-специфической делецией T reg Семейство miR-23 ~ 27 ~ 24 (T reg -DKO) содержало эквивалентное количество T FH и GC B-клеток по сравнению с их однопометниками WT (рис.S6).

    Рис. 1 Члены семейства miR-23 ~ 27 ~ 24 совместно ограничивают клеточные ответы T FH .

    ( A ) Анализ клеточной сортировки с активацией флуоресценции (FACS), ( B ) частоты и количество клеток CXCR5 + PD1 + T FH и PNA + GL7 + GC B клеток в селезенке мышей T-DKO в возрасте ~ 8 недель или их однопометников WT через 8 дней после инфицирования LCMV. ( C ) Иммуногистологические анализы реакций GC в селезенке, инфицированной LCMV, которые были криогенно удалены и окрашены CD4 (красный), GL7 (зеленый) и IgD (синий).( D ) Иммуноферментный анализ общих уровней LCMV-специфических IgG в сыворотке от LCMV-инфицированных мышей T-DKO или однопометников WT. OD450 нм, оптическая плотность при 450 нм. Частоты ( E ) CXCR5 + PD1 + T FH клеток и ( F ) PNA + GL7 + GC B-клеток в селезенке от мышей 23CTg в возрасте ~ 8 недель или их однопометники WT через 8 дней после заражения LCMV. Частоты ( G ) CXCR5 + PD1 + T FH клеток и ( H ) PNA + GL7 + GC B-клеток в селезенке от ~ 8-недельного возраста 23Tg, 24Tg , или 27Tg мышей и их соответствующие однопометники WT через 8 дней после заражения LCMV.Данные представляют от трех до четырех независимых экспериментов. Каждый символ представляет мышь, а полоса представляет собой среднее значение. * P <0,05, ** P <0,01 и *** P <0,001.

    Отдельные члены семейства miR-23 ~ 27 ~ 24 совместно регулируют ответы клеток T

    FH

    Ранее было показано, что отдельные члены семейства miR-23 ~ 27 ~ 24 противостоят друг другу, чтобы точно настроить ответы других T клеточные линии ( 13 , 15 ). Чтобы определить влияние отдельных членов семейства miR-23 ~ 27 ~ 24 на клетки T FH , мы использовали ранее созданных мышей, у которых весь кластер miR-23a ~ 27a ~ 24-2 (23CTg) или отдельные члены (23Tg, 24Tg или 27Tg) были избирательно сверхэкспрессированы в Т-клетках ( 13 ). В отличие от усиленных клеточных ответов T FH , наблюдаемых у мышей T-DKO, мыши 23CTg, инфицированные LCMV, обладали пониженной частотой клеток T FH наряду со сниженными ответами GC B-клеток (рис.1, E и F и рис. S7). Дальнейший анализ на мышах 23Tg, 24Tg и 27Tg показал, что, в отличие от других линий T-клеток, ответы клеток T FH совместно контролируются всем семейством miR-23 ~ 27 ~ 24, как у мышей с Т-клеточно-специфической сверхэкспрессией отдельных особей. Все члены семейства miR-23 ~ 27 ~ 24 проявляли скомпрометированные ответы клеток T FH и GC B при инфицировании LCMV (рис. 1, G и H).

    кластеров miR-23 ~ 27 ~ 24 нацелены на множественные гены, связанные с клеточной биологией T

    FH

    На сегодняшний день многие мишени семейства miR-23 ~ 27 ~ 24 были идентифицированы как участники регуляторного воздействия на различные аспекты Т-клеточного иммунитета ( 13 15 , 18 ).Хотя влияние опосредованной семейством miR-23 ~ 27 ~ 24 регуляции гена на клетки T FH ранее не изучалось, известно, что несколько ранее идентифицированных мишеней регулируют биологию клеток T FH . Например, TCF1, фактор транскрипции, на который нацелен miR-24, чтобы способствовать эффекторной функции T H 1 и T H 17, недавно продемонстрировал решающее значение для установления программы транскрипции клеток T FH ( 16 , 17 ).Следовательно, возможно, что miR-24 может управлять клетками T FH посредством модуляции количества TCF1. Точно так же, в дополнение к описанной роли c-REL в опосредованной miR-27 регуляции дифференцировки и гомеостаза клеток T reg ( 14 ), miR-27 также может ограничивать клеточные ответы T FH путем нацеливания на c- REL, как было показано ранее, способствует образованию и функционированию клеток T FH посредством управления экспрессией IL-21 и CD40L ( 21 , 22 ).Тем не менее, остается неясным, как miR-23 регулирует клетки T FH . Более того, для обеспечения их биологического воздействия также вероятно, что семейство miR-23 ~ 27 ~ 24 контролирует биологию клеток T FH посредством нацеливания на множественные гены, необходимые для дифференцировки и функции клеток T FH , аналогично тому, как они регулируют иммунитет T H 2 ( 13 , 18 ).

    Для поиска новых мишеней, которые могли бы объяснить опосредованную семейством miR-23 ~ 27 ~ 24 регуляцию клеточных ответов T FH , мы воспользовались преимуществом ранее описанного высокопроизводительного секвенирования РНК, выделенных путем перекрестной иммунопреципитации ( HITS-CLIP), созданная in vitro активированными CD4 + Т-клетками ( 23 ).Поскольку miRNA направляют белки Argonaute (AGO) на посттранскрипционную репрессию своих мРНК-мишеней, посредством поиска совпадений семян miRNA в HITS-CLIP-идентифицированных областях, связанных с AGO, мы идентифицировали гены, ассоциированные с клетками T FH с предполагаемым связыванием miR-23. , miR-24 или miR-27. Затем с помощью анализа репортерной люциферазы и / или анализа клеточной сортировки, активируемой флуоресценцией (FACS), исследовали прямые регуляторные эффекты на эти потенциальные мишени из этого семейства miRNA. Как показано на рис.2 (A – D), мы идентифицировали c-MAF как прямую мишень miR-23. Ранее было показано, что c-MAF, индуцированный передачей сигналов ICOS, способствует дифференцировке и функционированию клеток T FH , индуцируя продукцию IL-21 ( 9 ). Следовательно, miR-23 может вносить вклад в регуляцию клеток T FH посредством нацеливания на c-MAF. Более того, наши исследования также показали, что сам ICOS может быть непосредственно репрессирован miR-27, таким образом добавляя ICOS в качестве другой мишени miR-27, которая участвует в дифференцировке клеток T FH (рис.2, с E по H). Принимая во внимание тот факт, что как ICOS, так и c-MAF регулируются семейством miR-23 ~ 27 ~ 24, ожидается, что значительно больше Т-клеток, продуцирующих IL-21, с повышенной экспрессией IL-21 на клеточную основу , были обнаружены у мышей T-DKO по сравнению с их однопометниками дикого типа (рис. 2, I — K). Дальнейший анализ 3′-нетранслируемой области IL-21 (3’UTR) выявил предполагаемый сайт связывания miR-24, несмотря на отсутствие положительного сигнала связывания AGO из анализа HITS-CLIP (фиг. 2L). Тем не менее, наш анализ репортера люциферазы подтвердил, что miR-24 действительно может напрямую репрессировать IL-21 (рис.2M), предполагая, что минимальная экспрессия IL-21 в Т-клетках, использованных для исследования HITS-CLIP, вероятно, может быть причиной отсутствия положительных результатов ( 23 ). Наконец, поскольку ранее было показано, что передача сигналов ICOS и IL-21 индуцирует экспрессию BCL6 ( 4 , 6 ), хотя сам BCL6 не является прямой мишенью этого семейства miRNA, клетки T-DKO T FH экспрессировали значительно увеличил количество BCL6 на клеточную основу по сравнению с их аналогами WT (рис. 2N).Таким образом, несмотря на наблюдение, что регуляторный эффект кластеров miR-23 ~ 27 ~ 24 на каждую мишень, по-видимому, невелик, члены этого семейства miRNA могут контролировать экспрессию BCL6 и программы дифференцировки клеток T FH посредством кооперативная регуляция сети генов, критически важных для клеточной биологии T FH .

    Рис. 2 Множественные гены, ассоциированные с клетками T FH , являются мишенями семейства miR-23 ~ 27 ~ 24.

    ( A ) анализ HITS-CLIP и ( B ) выравнивание последовательности предполагаемого сайта miR-23 в 3’UTR c-MAF.( C ) Соотношения репрессированной люциферазной активности клеток в присутствии c-MAF 3’UTR с мутациями или без мутаций в посевных последовательностях в присутствии miR-23 по сравнению с клетками, трансфицированными контрольной miRNA. ( D ) Процент средней геометрической интенсивности флуоресценции c-MAF (gMFI) в клетках CXCR5 + PD1 + T FH от мышей T-DKO или 23Tg над однопометниками WT. ( E ) анализ HITS-CLIP и ( F ) выравнивание последовательности предполагаемого сайта miR-27 в 3’UTR ICOS.( G ) Соотношения репрессированной люциферазной активности клеток в присутствии ICOS 3’UTR с мутациями или без мутаций в посевных последовательностях в присутствии miR-27 по сравнению с клетками, трансфицированными контрольной miRNA. ( H ) Процент ICOS gMFI в клетках CXCR5 + PD1 + T FH мышей T-DKO или мышей 27Tg по сравнению с однопометниками WT. ( I ) FACS-анализ, ( J ) частоты и ( K ) процент IL-21 gMFI в in vitro-активированных CD4 + Т-клетках от мышей T-DKO или 24Tg над однопометниками WT.( L ) Выравнивание последовательностей предполагаемого сайта miR-24 в 3’UTR IL-21. ( M ) Соотношения репрессированной люциферазной активности клеток в присутствии 3’UTR IL-21 с мутациями или без мутаций в посевных последовательностях в присутствии miR-24 по сравнению с клетками, трансфицированными контрольной miRNA. ( N ) FACS-анализ и процентное содержание BCL6 gMFI в клетках CXCR5 + PD1 + T FH от мышей T-DKO или 24Tg от однопометников WT. Данные представляют из трех независимых экспериментов.Каждый символ представляет образец мыши или ячейки, а полоса представляет собой среднее значение. * P <0,05, ** P <0,01 и *** P <0,001. nt, нуклеотид.

    TOX, мишень для miR-23 и miR-27, сильно активируется в клетках T

    FH с помощью BCL6

    . FH , мы затем попытались изучить, может ли это семейство miRNA контролировать клеточные ответы T FH посредством регулирующих генов, которые еще не связаны с биологией клеток T FH .С этой целью мы сначала провели анализ транскриптома четырех популяций Т-клеток, включая CD44 CD4 + наивные Т-клетки (T n ), CD44 + PSGL1 hi CXCR5 CD4 + Т-клетки (T H 1), CD44 + PSGL1 int CXCR5 + CD4 + Т-клетки (T FH ) и CD44 + PSGL1 lo CX478479 + Т-клеток (GC-T FH ), выделенных из инфицированных LCMV мышей T-DKO или однопометников WT, как описано ранее (рис.S8) ( 16 ). Гены, которые были специфически активированы в T FH и / или GC-T FH , были выбраны для дальнейшего анализа (кластеры III, IV и V на фиг. 3A и в таблицах с S1 по S3). Затем, чтобы идентифицировать мишени семейства miR-23 ~ 27 ~ 24 в клетках T FH , мы сначала исследовали гены, которые значительно активируются в T клетках, лишенных опосредованной семейством miR-23 ~ 27 ~ 24 репрессии. Как показано на фиг. 3B, было обнаружено, что в клетках T FH и GC-T FH повышается регуляция большего количества генов по сравнению с клетками T n и T H 1, выделенными от мышей T-DKO, которые согласуется с наблюдаемой ролью этого семейства miRNA в ограничении клеточных ответов T FH (кластеры I и II; таблицы S4 и S5).Поскольку в этот список также входят гены, которые косвенно репрессируются этим семейством miRNA, был проведен беспристрастный анализ вышеупомянутых результатов HITS-CLIP для идентификации всех генов, которые могут быть непосредственно распознаны семейством miR-23 ~ 27 ~ 24 ( таблицы с S6 по S8). Наконец, учитывая, что BCL6 служит определяющим регулятором транскрипции клеток T FH ( 7 , 24 ), мы пришли к выводу, что гены, непосредственно нацеленные на BCL6, вероятно, будут более функционально важны для регуляции биологии клеток T FH . и поэтому были включены в наш окончательный анализ.Вместе, посредством выполнения анализа диаграммы Венна на сгенерированных нами результатах секвенирования РНК (RNA-seq) в сочетании с вышеупомянутым анализом HITS-CLIP на предполагаемых сайтах связывания семейства miR-23 ~ 27 ~ 24 и общедоступной иммунопреципитации хроматина с последующим глубоким секвенированием (ChIP -seq) исследования BCL6-связанных генов в клетках мыши T FH ( 24 ), Tox оказался единственным перекрывающимся геном во всех четырех наборах данных (рис. 3C).

    Инжир.3 miR-23 и miR-27 совместно репрессируют TOX, фактор транскрипции, который сильно активируется BCL6 в клетках T FH .

    ( A ) РНК-seq анализ генов, которые дифференциально экспрессировались в клетках T n 1, T H 1, T FH и GC-T FH , выделенных от мышей WT B6 через 8 дней после LCMV-инфекция. ( B ) Были показаны гены, которые были активированы в различных подмножествах Т-клеток T-DKO по сравнению с их соответствующими аналогами WT. ( C ) Анализ диаграммы Венна генов, обогащенных клетками T FH и / или GC-T FH , дополнительно активированных в клетках T-DKO T FH и / или GC-T FH , содержащие предполагаемые мишени семейства miR-23 ~ 27 ~ 24 с помощью HITS-CLIP и связанные BCL6 в клетках T FH .Анализ FACS и gMFI количества белка TOX в ( D ) различных субпопуляциях Т-клеток от мышей WT B6 или ( E ) PSGL lo CXCR5 + GC-T Клетки FH от мышей T-DKO или WT однопометники. ( F ) анализ HITS-CLIP и ( G ) выравнивание последовательностей предполагаемых сайтов miR-23 и miR-27 в 3’UTR TOX. Соотношения репрессированной люциферазной активности клеток в присутствии TOX 3’UTR с соответствующими мутациями в посевных последовательностях или без них в присутствии ( H ) miR-23 или ( I ) miR-27 по сравнению с клетками, трансфицированными контроль miRNA.( J ) Количество gMFI белка TOX в клетках PSGL lo CXCR5 + GC-T FH от мышей 23CTg, 23Tg, 24Tg или 27Tg и их соответствующих однопометников WT. ( K ) FACS-анализ экспрессии белка TOX в BCL6-дефицитных Т-клетках, трансдуцированных BCL6-экспрессирующими или контрольными ретровирусными векторами. Клетки, которые экспрессировали разные количества BCL6 (lo, int или hi), были изолированы индивидуально. ( L ) Анализ FACS и процентное содержание TOX gMFI в BCL6 lo, int., и hi популяции из Т-клеток, повторно экспрессирующих BCL6, по сравнению с Т-клетками, трансдуцированными контрольным вектором. Данные представляют из трех независимых экспериментов. Каждый символ представляет образец мыши или ячейки, а полоса представляет собой среднее значение. * P <0,05, ** P <0,01 и *** P <0,001.

    TOX, член более крупного суперсемейства HMG-box, как известно, имеет решающее значение для развития CD4 + Т-клеток в тимусе ( 25 ). Однако на периферии его роль в CD4 + Т-клетках еще предстоит определить.С этой целью мы сначала подтвердили наши результаты РНК-секвенирования, исследуя уровни белка ТОХ в различных подмножествах Т-клеток. В соответствии с нашими результатами RNA-seq, мы обнаружили, что TOX экспрессировался на низких уровнях как в T n , так и в T H 1 клетках, но индуцировался в клетках T FH и далее повышался в GC-T FH. ячеек (рис. 3D). Более того, клетки T FH от мышей T-DKO также экспрессировали больше TOX по сравнению с их аналогами WT (фиг. 3E). Кроме того, в соответствии с результатами анализа HITS-CLIP (рис.3F) наши данные о репортере люциферазы продемонстрировали, что Tox может быть непосредственно репрессирован с помощью miR-23 и miR-27, несмотря на то, что первый сайт связывания miR-23, по-видимому, не функционировал (рис. 3, G к I). В качестве дополнительной поддержки этих открытий, снижение экспрессии белка ТОХ на клеточной основе может быть обнаружено в клетках T FH со сверхэкспрессией только miR-23, только miR-27 или всего семейства miR-23 ~ 27 ~ 24. но не в клетках со сверхэкспрессией miR-24 (фиг. 3J и фиг. S9).Наконец, чтобы подтвердить, что экспрессия TOX действительно регулируется BCL6, как предполагалось в предыдущем отчете ( 24 ), мы ретровирусно ввели BCL6 в BCL6-аблированные CD4 + Т-клетки (обработанные тамоксифеном Т-клетки, выделенные из CD4 Ert2cre Bcl6 fl / fl мышей) и исследовали экспрессию TOX. Как показано на фиг. 3 (K и L), повторная экспрессия BCL6 не только приводила к индукции TOX, но и количества TOX также демонстрировали положительную корреляцию с количествами BCL6 в клетках.Вместе мы идентифицировали TOX как новую мишень для miR-23 и miR-27, которая сильно активируется в клетках T FH BCL6-зависимым образом.

    Ось BCL6-TOX консервативна в клетках T

    FH человека

    Хотя многие программы дифференцировки клеток и функциональные особенности являются общими для мышиных и человеческих клеток T FH , различия в клетках T FH между этими двумя видами также хорошо известны ( 26 ). Следовательно, неясно, является ли наше открытие оси BCL6-TOX в клетках мыши T FH консервативным и у человека.Ранее было проведено ChIP-seq исследование цис-регуляторных областей, связанных с BCL6, с анализом транскриптома и эпигенома в клетках GC-T FH первичных миндалин человека, чтобы изучить влияние BCL6 на биологию клеток T FH человека ( ). В этом исследовании были идентифицированы два значительных связывания BCL6 с промоторной областью локуса TOX в клетках GC-T FH , результат, который мы подтвердили повторным анализом этого набора данных (рис. 4A). Эти связывания происходят вместе с очевидным обогащением h4K27ac и h4K4me3, сигнатурной характеристикой активно транскрибируемых генов (рис.4А). Хотя обычно считается, что BCL6 функционирует как репрессор транскрипции, наш анализ вышеупомянутого исследования профилей экспрессии генов в человеческих CD4 + Т-клетках четко продемонстрировал увеличение экспрессии TOX в клетках с усиленной экспрессией BCL6 (рис. 4B) ( 7 ). Более того, в соответствии с нашими данными на мышах, самые высокие уровни экспрессии TOX были обнаружены в клетках GC-T FH человека по сравнению с популяцией не-T FH клеток с клетками T FH , демонстрирующими промежуточное соединение TOX . уровни транскрипции (рис.4С). Наконец, мы стремились изучить уровни белка ТОХ в человеческих CD4 + Т-клетках. В соответствии с нашими результатами в исследовании на мышах, в лимфатических узлах человека мы наблюдали наибольшее количество TOX в клетках CD45RO + CXCR5 hi PD1 hi CD4 + GC-T FH по сравнению с клетками в клетках Клетки T FH и не относящиеся к T FH (рис.4, D и E). Более того, в популяции клеток GC-T FH также было обнаружено значительное увеличение экспрессии белка TOX пропорционально количеству BCL6 (рис.4, F и G). Таким образом, ось BCL6-TOX в клетках T FH является консервативной для человека и мышей и, вероятно, других видов.

    Фиг. 4 BCL6 нацелен на TOX в человеческих клетках T FH .

    ( A ) ChIP-seq анализ BCL6 (два повтора) или гистона h4, ацетилированного по Lys 27 (h4K27ac), монометилированного по Lys 4 (h4K4me1) или триметилированного по Lys 4 90me1 (h4K4K) входные контроли на TOX в человеческих клетках GC-T FH представлены в виде чтения на миллион на нуклеотид (об / мин / п.н.).Были помечены ранее идентифицированные BCL6-положительные связывания. Кратковременные изменения экспрессии TOX в ( B ) Т-клетках, трансдуцированных лентивирусным вектором, экспрессирующим BCL6, по сравнению с не-T клетками FH или Т-клетками, трансдуцированными контрольным вектором, и в ( C ) человеческих не-T Клетки FH , T FH или GC-T FH соответственно. FACS-анализ ( D ) CD4 + CD45RO Т-клеток и CD4 + CD45RO + Т-клеток из лимфатических узлов (ЛУ) человека.CXCR5 hi PD1 hi GC-T FH , CXCR5 int PD1 int T FH и CXCR5 PD1 non-T FH клетки CD45RO + Т-клетки) были стробированы для ( E ) анализа FACS, и показаны проценты TOX gMFI по сравнению с CD4 + CD45RO Т-клетками. ( F ) CXCR5 hi PD1 hi GC-T FH клетки, которые экспрессировали различные количества BCL6 (lo, int., или привет) были индивидуально закрыты. ( G ) FACS-анализ и процентное содержание TOX gMFI в популяциях lo, int и hi BCL6 из CD4 + CD45RO + CXCR5 hi PD1 hi GC-T FH клеток по сравнению с CD4 + Показаны CD45RO Т-клетки. Данные представляют из трех независимых экспериментов. Каждый символ представляет человека-донора, а полоса представляет собой среднее значение. * P <0,05 и *** P <0,01.

    Модуляция уровней TOX в T-клетках влияет на T

    FH клеточные ответы

    Учитывая, что TOX индуцируется в клетках T FH с помощью BCL6, мы затем попытались определить, играет ли TOX функциональную роль в регуляции клеток T FH ответы in vivo.С этой целью мы сначала трансдуцировали CD4 + Т-клетки, выделенные от мышей SMARTA (которые экспрессируют IA b -ограниченный Т-клеточный рецептор, специфичный для аминокислот гликопротеина LCMV с 66 по 77) ретровирусным вектором, экспрессирующим короткую шпилечную РНК, специфичную для для TOX (shTOX) вместе с репортером зеленого флуоресцентного белка (GFP) ( 27 ). Экспрессия shTOX в Т-клетках SMARTA CD4 + привела к небольшому, но заметному снижению (~ 25%) экспрессии TOX (рис. S10A). Далее мы перенесли отсортированные shTOX-преобразованные GFP + Ly5.1 + SMARTA CD4 + Т-клеток в генетически маркированных Ly5.2 + B6-хозяев и проанализировали мышей-реципиентов через 7 дней после острой инфекции LCMV. Как показано на рис. S10B, мы могли наблюдать снижение частоты SMARTA SLAM lo CXCR5 + T FH клеток или BCL6 + CXCR5 + GC-T FH клеток у мышей, получавших SMARTA CD4 + T-клетки с вектором, экспрессирующим shTOX, по сравнению с векторами с контрольным вектором pMDH.Более того, когда Tox был разрушен с помощью недавно созданной системы CRISPR на основе плазмид, управляемой РНК ( 28 ), можно было наблюдать дальнейшее снижение как T FH , так и GC-T FH клеток (рис. , А и Б). Затем, чтобы дополнительно изучить роль TOX в стимулировании клеточных ответов T FH , мы применили подход увеличения функции путем ретровирусной трансдукции SMARTA CD4 + Т-клеток с помощью вектора, содержащего репортер GFP, экспрессирующего TOX. В отличие от того, что было показано в вышеупомянутом исследовании потери функции TOX, усиленная экспрессия TOX в Т-клетках SMARTA CD4 + приводила к значительно более высоким частотам как T FH , так и GC-T FH клеток во время инфекции LCMV. (Инжир.5, В и Г). Следует отметить, что модуляция количества ТОХ в Т-клетках, по-видимому, не влияла на общий гомеостаз Т-клеток, поскольку наблюдались аналогичные частоты клеток SMARTA + с избыточной экспрессией или удалением ТОХ в общей популяции Т-клеток CD4 + по сравнению с их соответствующие органы управления (рис. S11). Таким образом, наши данные ясно продемонстрировали присущую клетке роль TOX в управлении клеточными ответами T FH и что уровень экспрессии TOX необходимо жестко регулировать для обеспечения оптимальных клеточных ответов T FH .

    Рис. 5 Модуляция уровней TOX в Т-клетках влияет на ответы клеток T FH . Показаны

    ( A ) FACS-анализ и процентное содержание TOX gMFI в CD4 + SMARTA T-клетках, электропорированных с помощью плазмиды, экспрессирующей Tox-гид РНК (gRNA) / Cas9, по сравнению с клетками, трансдуцированными контрольной плазмидой. ( B ) FACS-анализ и частота клеток SLAM lo CXCR5 + T FH или BCL6 + CXCR5 + GC-T FH клеток в реципиентах B6, перенесенных с конгенированно маркированными + GFP Tox-gRNA + CD4 + SMARTA T-клетки или контрольные клетки через 7 дней после заражения LCMV.( C ) FACS-анализ и процентное содержание TOX gMFI в CD4 + Т-лимфоциты SMARTA, ретровирусно трансдуцированные вектором, экспрессирующим TOX, по сравнению с клетками, трансдуцированными контрольным вектором. ( D ) FACS-анализ и частота клеток SLAM lo CXCR5 + T FH или BCL6 + CXCR5 + GC-T FH клеток в реципиентах B6, перенесенных с конгенно маркированным GFP pTOX + CD4 + SMARTA T-клетки или контрольные клетки через 7 дней после заражения LCMV.Данные представляют два независимых эксперимента. Каждый символ представляет мышь, а полоса представляет собой среднее значение. *** P <0,001.

    TOX способствует экспрессии множества молекул T

    FH , связанных с клетками

    Недавно исследование Т-лимфоцитов CD8 + во время воспаления центральной нервной системы показало, что экспрессия TOX может придавать CD8 способность к разрушению тканей + Т-клеток за счет подавления активности ID2.Было показано, что TOX может напрямую нацеливаться на Id2 и что потеря TOX привела к увеличению экспрессии Id2 в CD8 + Т-клетках ( 27 ). Принимая во внимание ранее сообщенную роль ID2 в ограничении дифференцировки клеток T FH ( 29 ), мы стремились определить, может ли TOX также способствовать клеточным ответам T FH посредством репрессии Id2 . С этой целью мы исследовали экспрессию мРНК Id2 в Т-клетках CD4 + , ретровирусно трансдуцированных вышеупомянутым вектором, экспрессирующим ТОХ.Неожиданно, несмотря на явное увеличение экспрессии TOX, наблюдалась сопоставимая (если не более высокая) экспрессия Id2 в клетках T FH (рис. S12A), что, по-видимому, несовместимо с предыдущим исследованием CD8 ( 27 ). Следует отметить, что, однако, хотя более высокие уровни Id2 были обнаружены в TOX-дефицитных CD8 + T-клетках с помощью анализа количественной полимеразной цепной реакции (qPCR) в этом исследовании ( 27 ), были получены противоположные результаты. когда их набор данных RNA-seq от TOX-дефицитных и TOX-достаточных CD8 + Т-клеток был повторно проанализирован (рис.S12B). Последнее открытие было дополнительно подтверждено другим исследованием, в котором было показано, что TOX имеет решающее значение для раннего развития линии врожденных лимфоидных клеток (ILC) ( 30 ). Было обнаружено, что не только Tox и Id2 коэкспрессируются в общих предшественниках ILC, но потеря TOX также привела к значительному подавлению экспрессии Id2 (фиг. S12C). Аналогичные результаты были также продемонстрированы в тимоцитах CD4SP, в которых экспрессия Id2 была значительно снижена в отсутствие TOX ( 31 ).Вместе эти результаты вместе с нашими находками в клетках T FH опровергают роль репрессора транскрипции TOX в регуляции экспрессии Id2 и предполагают, что TOX вряд ли способствует клеткам T FH посредством репрессии Id2 .

    Чтобы получить дополнительную молекулярную информацию о TOX-зависимой дифференцировке клеток T FH , мы выполнили анализ диаграммы Венна вышеупомянутых исследований профилей экспрессии генов в CD8 + T-клетках и общих предшественниках ILC ( 27 , 30 ) .Мы предположили, что основные TOX-зависимые гены, идентифицированные в наборах данных, созданных из двух разных популяций иммунных клеток, будут иметь более высокую вероятность того, что они обычно регулируются TOX в клетках T FH . С этой целью было показано, что 142 гена совместно регулируются с помощью TOX как в Т-клетках CD8 + , так и в общих предшественниках ILC (фиг. 6A и таблица S9). Среди них пять генов ( Icos , Lef1 , Maf , Pdcd1 и Tcf7 ), которые, как ранее было показано, имеют решающее значение в биологии клеток T FH , имеют значительно более низкую экспрессию в TOX. -дефицитные клетки по сравнению с их соответствующими аналогами дикого типа (рис.6Б) ( 2 ). Затем мы выполнили анализ qPCR, чтобы подтвердить, может ли экспрессия этих молекул также управляться TOX в CD4 + T-клетках. Как показано на фиг. 6С и фиг. S12 (D и E), в то время как экспрессия Icos и Maf не была изменена в CD4 + Т-клетках со сверхэкспрессией TOX, было легко обнаружено значительное увеличение экспрессии Tcf7 , Lef1 и Pdcd1 . Более того, TOX-зависимая повышающая регуляция TCF1 (кодируется Tcf7 ), LEF1 и PD1 (кодируется Pdcd1 ) дополнительно подтверждается наблюдением положительной корреляции между количествами TOX и теми молекулами в TOX-сверхэкспрессии. ячейки (рис.6, Г к I). Вместе эти данные предполагают, что TOX может способствовать клеточным ответам T FH за счет индукции экспрессии нескольких генов, критических для дифференцировки и функционирования клеток T FH ( 16 , 32 ).

    Фиг. 6 TOX способствует экспрессии множества генов, важных для дифференцировки и функционирования клеток T FH .

    ( A ) Анализ диаграммы Венна генов, которые дифференциально экспрессировались между TOX-дефицитными и TOX-достаточными клетками в CD8 + T-клетках и общих предшественниках ILC.Данные РНК-seq для CD8 + Т-клеток и обычных предшественников ILC были получены из GenBank под регистрационным номером GSE и GSE65850 соответственно. КО, нокаут. Показаны гены, ассоциированные с T FH , которые подавлялись как в TOX-дефицитных Т-клетках CD8 + , так и в обычных предшественниках ILC (по сравнению с их соответствующими контрольными группами). ( C ) Анализ кПЦР экспрессии Tcf7 , Lef1 и Pdcd1 в Т-клетках со сверхэкспрессией TOX.FACS-анализ экспрессии белков ( D ) TCF1, ( E ) LEF1 и ( F ) PD1 в Т-клетках со сверхэкспрессией TOX по сравнению с соответствующими контролями. Клетки, которые экспрессировали разные количества TOX (lo, int или hi), были изолированы индивидуально. Показан анализ FACS и процентное содержание ( G ) TCF1, ( H ) LEF1 и ( I ) PD1 gMFI в популяциях TOX lo, int. И hi из Т-клеток со сверхэкспрессией TOX по сравнению с контрольными популяциями клеток. Данные представляют из трех независимых экспериментов.Каждый символ представляет мышь, а полоса представляет собой среднее значение. * P <0,05, ** P <0,01 и *** P <0,001.

    ОБСУЖДЕНИЕ

    Иммунные ответы жестко контролируются многими различными клеточными и молекулярными игроками. Внутри данного типа иммунных клеток экспрессия различных наборов генов определяет исход переходных процессов в развитии или статус клеточной активации. Среди различных трансрегуляторов экспрессии генов факторы транскрипции и миРНК, вероятно, являются наиболее важными и широко изучаются на предмет их роли не только в иммунной системе, но и в других биологических процессах.В отличие от факторов транскрипции, обычно считается, что miRNA точно настраивают, а не радикально изменяют экспрессию своих мишеней. Тем не менее, посредством репрессии набора генов, которые находятся в общем пути или белковом комплексе, miRNA могут усилить свое влияние на регуляцию генов и, как следствие, биологию. В этом исследовании мы продемонстрировали, что семейство miRNA, кластеры miR-23 ~ 27 ~ 24, может контролировать дифференцировку и функцию клеток T FH , ключевого субнабора Т-клеток, необходимого для генерации защитного гуморального иммунитета.Хотя регуляторный эффект кластеров miR-23 ~ 27 ~ 24 на каждую мишень казался скромным, это семейство miRNA регулирует клеточные ответы T FH посредством совместного воздействия на сеть генов, включая фактор транскрипции TOX, роль которого в T FH клеток ранее не распознавались. TOX и другие мишени семейства miR-23 ~ 27 ~ 24, в свою очередь, контролируют другие критические компоненты, важные для клеточной биологии T FH . В совокупности наша работа иллюстрирует скоординированную регуляцию микроРНК и факторов транскрипции, которые обеспечивают производство соответствующих иммунных ответов во время различных иммунологических проблем.

    Ранее наша работа уже установила кластеры miR-23 ~ 27 ~ 24 в качестве ключевого семейства miRNA в контроле Т-клеточного иммунитета ( 13 15 ). Однако одной из главных загадок в наших более ранних исследованиях было представление о том, что отдельные члены этого семейства miRNA, по-видимому, не работают вместе, чтобы регулировать данный ответ Т-клеток. Например, в отличие от miR-27, которая играет отрицательную роль в регуляции всех клонов Т-клеток, miR-23, по-видимому, функционально незаменима для контроля иммунитета к T H 1 и T H 2 ( 13 ).С другой стороны, хотя miR-24 ограничивает клеточные ответы T H 2 вместе с miR-27, на самом деле он противодействует miR-27 регуляции T H 1 и T H 17 за счет стимулирования продукции соответствующих эффекторных цитокинов ( 15 ). Тот факт, что клетки T FH , но не другие Т-хелперные клетки, совместно регулируются всеми тремя членами, предполагает, что ответы клеток T FH необходимо более строго контролировать. Можно спросить, что делает клетки T FH более уникальными, чем другие клоны Т-хелперных клеток.В конце концов, каждая подгруппа Т-клеток играет свою индивидуальную роль в защите хозяина от различных типов патогенов, и нарушение регуляции любых ответов Т-хелперных клеток может привести к соответствующим аутоиммунным заболеваниям. Тем не менее, это не первый случай, когда сообщается о дифференциальной регуляции различных подмножеств Т-хелперных клеток ( 33 ). Было показано, что иммунитет к T H 2 более строго регулируется клетками T reg , чем аналогом T H 1, поскольку даже умеренное количество клеток T reg было способно эффективно подавлять T H 2. клеточный ответ.Следовательно, хотя одни и те же клетки (например, клетки T reg ) или молекулярные игроки (например, кластеры miR-23 ~ 27 ~ 24) могут контролировать несколько клонов Т-клеток, они также могут предпочтительно регулировать конкретный тип ответа Т-клеток. Хотя точная причина этой специализированной регуляции еще не выяснена, она дает возможность разработать целевые терапевтические стратегии против выбранного заболевания, вызванного данным происхождением Т-клеток.

    TOX изначально был охарактеризован как ключевой фактор транскрипции в развитии тимоцитов.Позже было показано, что он играет более специфическую роль в развитии Т-лимфоцитов CD4 + , поскольку у мышей с дефицитом ТОХ наблюдается серьезное нарушение развития Т-клеток CD4 + , в то время как компартмент Т-клеток CD8 + был затронут лишь минимально 25 ). Было показано, что за пределами клонов Т-клеток TOX имеет решающее значение для образования естественных клеток-киллеров и других подмножеств ILC ( 30 , 34 ). Вместе эти результаты, по-видимому, указывают на большую роль TOX в регулировании развития различных иммунных подгрупп.Тем не менее, функция TOX в контроле реакций периферических эффекторных клеток стала оцениваться только недавно ( 27 ). Одним из наиболее интересных открытий в нашем текущем исследовании является идентификация TOX как центрального регулятора транскрипции, контролирующего дифференцировку и функцию клеток T FH . Более того, повышенная экспрессия TOX в клетках GC-T FH (и в клетках T FH в меньшей степени) индуцируется BCL6 как у человека, так и у мышей. Учитывая, что ранее было показано, что BCL6 действует в основном как репрессор транскрипции, а не как активатор ( 7 ), этот результат является довольно неожиданным.Однако следует отметить, что вышеупомянутое исследование цис-регуляторных областей, связанных с BCL6, показало, что основная часть связывания BCL6 в клетках GC-T FH происходит в промоторах, обогащенных модификациями гистонов (h4K4me1, h4K4me3 и h4K27ac) активно транскрибируемые гены ( 7 ). Следовательно, хотя BCL6 может преимущественно подавлять экспрессию гена, аналогично тому, что было описано в FOXP3-опосредованной регуляции гена в клетках T reg ( 35 ), он также может функционировать как активатор транскрипции для определенных мишеней при образовании комплексов с различными наборы связывающих партнеров, как было предложено ранее ( 7 ).Тем не менее остается вероятным, что BCL6 все еще может способствовать экспрессии Tox посредством репрессии других неизвестных негативных регуляторов TOX. Необходимы дальнейшие исследования, чтобы напрямую проверить эту возможность.

    Механически мы изначально предположили, что TOX может способствовать клеточным ответам Т FH посредством ингибирования экспрессии Id2 , как было предложено вышеупомянутым исследованием на CD8 + Т-клетках ( 27 ). Однако, противоречащие их открытиям, наши результаты не подтверждают, что TOX как репрессор транскрипции регулирует экспрессию Id2 в клетках T FH .Более того, учитывая наличие противоречивых результатов в различных исследованиях ( 27 , 30 , 31 ), точная роль TOX в регуляции Id2 требует дальнейшего уточнения, поскольку TOX может действовать мультимодальным образом для активировать или репрессировать экспрессию Id2 в зависимости от типа клетки и контекста. С другой стороны, хотя TCF1, LEF1 и PD1 были идентифицированы как управляемые TOX, способствующие клеточным ответам T FH , другие мишени TOX также могут быть вовлечены в TOX-зависимую биологию клеток T FH .Например, ранее было показано, что CD40L, молекула, которая имеет жизненно важное значение для взаимодействия клеток T FH с B-клетками во время GC-ответов, подавляется в TOX-дефицитных клетках CD4SP и предшественниках ILC ( 30 , 31 ), но он не был включен в наш анализ, поскольку он не был дифференциально экспрессируемым геном в Т-клетках CD8 + с дефицитом ТОХ ( 27 ). Таким образом, будущие исследования, включая профилирование экспрессии генов и / или анализ ChIP-seq на TOX-регулируемых генах, особенно в клетках T FH , имеют решающее значение для получения дополнительных механистических представлений о TOX-опосредованном контроле биологии клеток T FH .

    Ранее мы показали, что в других подмножествах Т-клеток кластеры miR-23 ~ 27 ~ 24, по-видимому, в первую очередь репрессируют свои мишени на уровне белка ( 13 15 ). Таким образом, мишени, экспрессия мРНК которых не изменилась между клетками WT и DKO, не будут включены в текущее исследование. Сходным образом, учитывая центральную роль BCL6 в организации программы дифференцировки клеток T FH , наша работа сосредоточена на генах, на которые непосредственно нацелен BCL6. Следовательно, гены, которые не связаны с BCL6, но имеют решающее значение для клеточной биологии T FH , такие как ASCL2, также будут исключены из нашего анализа.Тем не менее, наши подходы позволили нам идентифицировать TOX как новую мишень семейства miR-23 ~ 27 ~ 24, которая может играть важную роль в регуляции клеток T FH с помощью этого семейства miRNA. Вместе с другими мишенями, роль которых ранее была связана с биологией клеток T FH , наше исследование демонстрирует регулон miRNA, который координирует различные аспекты дифференцировки и функциональной программы клеток T FH . Тем не менее, дальнейшее углубленное изучение этого опосредованного семейством miRNA контроля клеточных ответов T FH необходимо для полного понимания того, как гуморальный иммунитет регулируется при многих различных иммунологических заболеваниях, таких как аутоиммунитет и инфекция, где сильный T FH клеточно-зависимый гуморальный иммунный ответ может быть вредным или полезным для здоровья хозяина.

    МАТЕРИАЛЫ И МЕТОДЫ

    Мыши

    Через скрещивание с мышами CD4-cre, мышей с Т-клеточной делецией miR-23 ~ 27 ~ 24 кластеров (T-DKO) или мышей, которые избирательно сверхэкспрессируют весь кластер miR-23a (23CTg) или отдельные элементы (23Tg, 24Tg и 27Tg) в Т-клетках ( 13 ), а также CD4 Ert2cre ( 36 ), Bcl6 fl / fl ( 37 ) , и мыши SMARTA ( 38 ) были описаны ранее.Клеточно-специфическая делеция T reg обоих кластеров miR-23 была достигнута путем скрещивания мышей miR-23 ~ 24 ~ 27a / b fl / f l с мышами Foxp3 cre . Мыши C57BL / 6J (B6), B6.SJL (Ly5.1 + B6) и Rag1 — / — были из лаборатории Джексона. Всех мышей выращивали и содержали в определенных условиях, свободных от патогенов. Если не указано иное, использовали мышей обоих полов в возрасте от 8 до 12 недель, и только однопометники дикого типа того же пола служили контролем в каждом эксперименте.В частности, мыши cre flox / flox и cre + были включены в качестве контрольных мышей «WT», поскольку они не показали какой-либо четкой разницы в наших исследованиях. Все мыши содержались и обрабатывались в соответствии с Руководящими принципами институционального ухода за животными и их использования Калифорнийского университета, Сан-Диего и Руководства Национального института здравоохранения по уходу и использованию лабораторных животных и руководящим принципам исследований на животных: отчетность об экспериментах in vivo (ARRIVE). .

    Инфекция LCMV и аллергическое воспаление дыхательных путей

    Запасы вируса LCMV Armstrong получали и количественно определяли, как описано ранее ( 19 ).Мышам внутрибрюшинно вводили 2 × 10 6 вирусов бляшкообразующих единиц (БОЕ) для исследования ответа на GC или 2 × 10 5 вирусов БОЕ для исследования переноса Т-клеток SMARTA CD4 + и умерщвляли на 8-й день. или 7 соответственно. Сыворотку собирали для измерения антител к вирусу. Для индукции аллергического воспаления дыхательных путей мышей сенсибилизировали и вводили им овальбумин (Worthington), как описано ранее ( 13 ).

    Создание смешанных химер BM

    Истощенные Т-лимфоцитами КМ-клетки, выделенные из бедренных и большеберцовых костей Ly5.2 + мышей T-DKO или их однопометников WT смешивали в соотношении 1: 1 с истощенными Т-клетками ВМ-клетками, взятыми у мышей Ly5.1 + WT B6 (2,5 × 10 6 каждая) и вводили внутривенно. в облученных (950 сГр) Rag1 — / — мышей. Мышей держали на воде с антибиотиком в течение 4 недель. Через восемь недель после переноса BM мышей подвергали исследованиям на инфекцию LCMV.

    Иммуноферментный анализ

    Концентрации общего IgG в сыворотке от астматической мыши оценивали с помощью наборов для иммуноферментного анализа в соответствии с инструкциями производителя (BioLegend).Для измерения Ab к LCMV очищенный антиген LCMV (0,5 мкг / мл) наносили на 96-луночный аналитический планшет Costar (Corning). Планшеты блокировали 1% бычьим сывороточным альбумином (BSA) в фосфатно-солевом буфере (PBS), и серийные разведения сыворотки в 1% BSA в PBS наносили на планшеты и инкубировали при комнатной температуре в течение 2 часов. После промывания планшеты инкубировали в течение 2 часов с антителами, конъюгированными с пероксидазой хрена, против общего мышиного IgG (Jackson ImmunoResearch), а затем с субстратом 3,3 ‘, 5,5’-тетраметилбензидина (BioLegend) для развития окраски.Поглощение измеряли при 450 нм с помощью считывающего устройства для микропланшетов (Molecular Devices).

    Иммунофенотипирование и проточная цитометрия

    Суспензии отдельных клеток были приготовлены из селезенки путем механического измельчения на предметных стеклах. Для всех анализов FACS клетки сначала окрашивали Ghost Dye Red 780 (Tonbo Biosciences), чтобы исключить мертвые клетки, с последующим окрашиванием. Окрашивание поверхности включает Ат против CD4, CD8α, CD44, PD1, ICOS, CD3ε, B220, GL7 и SLAM (все от Thermo Fisher Scientific) и агглютинина арахиса (PNA) (Vector Laboratories).Для окрашивания CXCR5 клетки окрашивали очищенными Ab против CXCR5 (BD Biosciences) в течение 1 часа с последующим окрашиванием биотинилированным козьим антителом против IgG крысы (Jackson ImmunoResearch) в течение 30 минут, а затем проводили окрашивание поверхности указанными Ab, а также меченный флуоресценцией стрептавидин (Thermo Fisher Scientific). LCMV-специфические Т-клетки CD4 + перед окрашиванием поверхности окрашивали тетрамером GP 66–77 : I-A b , предоставленным Национальным институтом здоровья, базирующимся на тетрамерах (Центр вакцин Эмори, Атланта, Джорджия).Набор для окрашивания FOXP3 / фактора транскрипции использовали для внутриклеточного окрашивания в соответствии с инструкциями производителя (Tonbo Biosciences). Внутриклеточное окрашивание на FOXP3, c-MAF, IL-21, TOX (все от Thermo Fisher Scientific), LEF1, TCF1 (оба от Cell Signaling Technology) и BCL6 (BD Biosciences) проводили после фиксации и пермеабилизации. Для обнаружения IL-21 отсортированные по FACS CD4 + CD25 CD62L hi Наивные Т-клетки в селезенке мышей WT и T-DKO в возрасте 6-8 недель стимулировали в течение 4 дней с помощью связанные анти-CD3 и анти-CD28 Abs (Bio X Cell) и рекомбинантный IL-6 (PeproTech) (20 мг / мл) в присутствии анти-IL-4 (10 мкг / мл) и анти-интерферона-γ (Ячейка Bio X).Для окрашивания лимфоцитов человека использовали Abs, специфичные против CD4 человека, CXCR5 и PD1 (BioLegend) и CD45RO (Tonbo Biosciences). Данные были собраны BD LSRFortessa (BD Biosciences) и оценены с помощью программного обеспечения FlowJo (FlowJo LLC).

    Иммуноокрашивание

    Свежеотрезанные селезенки быстро замораживали в Tissue-Tek O.C.T. (Сакура). Срезы толщиной 10 мкм вырезали с помощью CryoStar NX50 (Thermo Fisher Scientific), наносили на предметные стекла и фиксировали в холодном ацетоне в течение 20 мин с последующей сушкой на воздухе.После трехкратной промывки в PBS срезы окрашивали анти-IgD-PB для мечения зоны мантии фолликула, анти-CD4-фикоэритрином (PE) для идентификации Т-клеток, анти-GL7-флуоресцеин-изотиоцианатом или анти-IgD-eFluor 450 (все от Thermo Fisher Scientific) для исследования области ГХ в течение 30 минут при комнатной температуре. Изображения были получены на системе LSM 700 (Carl Zeiss Inc.).

    Анализ люциферазного репортера

    Области 3’UTR ICOS, c-MAF, IL-21 и TOX были амплифицированы из геномной ДНК мыши WT и клонированы в вектор psiCHECK-2 (Promega).Последовательности miR-23a, miR-24, miR-27a и miR-155 были соответственно клонированы в вектор ретровируса зеленого флуоресцентного белка, усиленного pMDH-PGK. Для создания мутантов ICOS, c-MAF, IL-21 и TOX 3’UTR проводили сайт-направленный мутагенез (Agilent Technologies). Клетки 293Т эмбриональной почки человека (НЕК) помещали на 24-луночный планшет за 1 день до трансфекции. psiCHECK-2, несущий 3’UTR дикого типа или соответствующий мутант 3’UTR, котрансфицировали вместе с контрольным вектором (miR-155) или плазмидой, экспрессирующей miRNA семейства miR-23 ~ 27 ~ 24, в клетки HEK293T с использованием FuGENE 6 (Promega).Активность люциферазы оценивали через 20 часов после трансфекции с использованием системы анализа Dual-Luciferase Reporter (Promega) в соответствии с протоколом производителя.

    Количественная ПЦР в реальном времени

    Для определения уровней экспрессии генов в Т-клетках, сверхэкспрессированных BCL6 или TOX, общая РНК отсортированных по FACS ретровирусных инфицированных клеток GFP + экстрагировалась с использованием набора miRNeasy (QIAGEN), комплементарные ДНК (кДНК) были созданы с помощью набора для синтеза кДНК iScript (Bio-Rad Laboratories), а ПЦР в реальном времени выполняли с использованием наборов SYBR Green PCR (Applied Biosystems).Для подтверждения уровней экспрессии кластеров miR-23 с помощью кПЦР была проведена ПЦР с обратной транскрипцией в реальном времени TaqMan (Thermo Fisher Scientific) с обратной транскрипцией в реальном времени. Все реакции в реальном времени проводили в системе 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific). Праймеры показаны в таблице S10.

    Производство и трансдукция ретровирусов

    Для сверхэкспрессии BCL6 использовали pMSCV-BCL6-IRES-GFP, подарок от H. Ye [плазмида Addgene номер 31391 ( 39 )]. Ретровирусы получали трансфекцией клеточной линии HEK293T, как описано ранее ( 13 ).FACS-отсортированные наивные Т-клетки из CD4 Ert2cre Bcl6 fl / fl мышей стимулировали в течение 24 часов в 24-луночных планшетах, предварительно покрытых анти-CD3 и анти-CD28, в присутствии 0,5 мкМ 4-гидрокситамоксифена (Sigma -Aldrich) и IL-2 (50 Ед / мл) с последующей инфекцией ретровирусным спином в течение 90 мин при 2000 об / мин в присутствии полибрена (8 мкг / мл) (Millipore). Экспрессию TOX в управляемой популяции GFP + исследовали через 3 дня после трансдукции с помощью FACS. Для модуляции TOX полноразмерные TOX и shTOX (OriGene) клонировали в векторы pMIGR1 или pMDH соответственно.FACS-отсортированные CD4 + CD25 CD62L hi Т-наивные клетки мышей WT или SMARTA стимулировали в лунках, покрытых анти-CD3 (2 мкг / мл) и анти-CD28 (2 мкг / мл), для 24 часа с ИЛ-2 (25 Ед / мл) с последующей инфекцией ретровирусным спином, как описано выше. Через 3 дня ретровирусной трансдукции клетки собирали и Т-клетки GFP + окрашивали выбранными наборами Ат для анализа FACS или сортировали для исследования переноса клеток SMARTA. В последнем исследовании всего 5 × 10 4 клеток GFP + (как для исследований с однократным, так и для совместного переноса) были перенесены внутривенно реципиенту с конгенированной меткой.

    Редактирование генов на основе CRISPR в первичных CD4 мыши

    + Т-клетки

    Управляемый промотором Cbh вектор CRISPR-Cas9, экспрессирующий вектор Cbh, был получен из модификации вектора pSpCas9 (BB) -2A-GFP [Addgene, номер плазмиды pX458 48138 ( 40 )] с клонированием Tox-направляющей РНК (гРНК) в вектор. Маркер GFP действует как индикатор для клеток-мишеней CRISPR. Последовательности пРНК были обозначены, нацеленные на Exon2: « ggctggctggcacatagtcc ». Конструирование и клонирование гРНК в векторы CRISPR-Cas9 выполняли, как описано ранее ( 41 ).

    FACS-отсортированные CD4 + CD25 CD62L hi Т-наивные клетки мышей SMARTA стимулировали в лунках, покрытых анти-CD3 (2 мкг / мл) и анти-CD28 (2 мкг / мл), для 24 часа с IL-2 (50 Ед / мл) с последующей электропорацией с помощью системы трансфекции неона (Invitrogen) при следующих условиях: напряжение (1400 В), длительность (50 мс), импульсы (один), наконечник на 100 мкл , и буфер Т. Клетки трансфицировали 6 мкг пустой плазмиды pX458 или pX458 с Tox-гРНК. После электропорации клетки высевали в 24-луночный планшет в 1 мл cRPMI 1640 с IL-2 (50 Ед / мл) в присутствии вышеупомянутых моноклональных антител, связанных с планшетом, в течение 1 дня и далее размножали в шестилуночном планшете. в 4 мл cRPMI 1640 с IL-2 (50 Ед / мл) без активации Abs в течение дополнительных 2 дней.Клетки GFP + были отсортированы с помощью FACS через 3 дня после электропорации и немедленно инъецированы мышам-реципиентам с генетической меткой для исследования переноса клеток SMARTA.

    Профилирование экспрессии генов и анализ данных ChIP-seq

    CD4 + CD25 CD44 наивные T (T n ) клетки, CD4 + CD25 CD44 + CXCR5 PSGL1 hi T H 1 клетки, CD4 + CD25 CD44 + CXCR5 + PSGL1 int T FH клетки и CD4

    58 + CD4

    58 + CXCR5 + PSGL1 lo GC-T Клетки FH в селезенке от мышей T-DKO, инфицированных LCMV, и контрольные WT были отсортированы на сортировщике клеток FACSAria II (BD Biosciences) с последующим выделением общей РНК с использованием miRNeasy Kit (QIAGEN).Поли-A-РНК-seq выполняли с использованием трех биологических повторов для каждой клеточной популяции, аналогично тому, что было описано ранее ( 13 ). Последовательные чтения были обрезаны или отфильтрованы для получения последовательности низкого качества или более короткой последовательности с помощью FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit), затем выровнены по эталонному геному мыши (mm9) и получили RPKM (Reads Per Килобаз транскрипта на миллион отображенных считываний) значений на ген с использованием Tophat / Cufflinks ( 42 ). Информация о генах была получена из браузера генома Калифорнийского университета в Санта-Крус (https: // genome.ucsc.edu/). Мы преобразовали необработанное измерение в баллы Z , относительную экспрессию гена во всех образцах дикого типа. Были отобраны гены с последовательным трехкратным значением T FH и / или GC-T FH и / или T n и / или T H 1. Чтобы определить, что гены выше в T-DKO, чем в клетках WT, только те гены с P <5% и значением log 2 раза изменяются более чем на 0,05 в T FH и / или GC-T Выбраны FH и / или T n и / или T H 1.Морфеус (https://software.broadinstitute.org/morpheus) использовался для создания тепловых карт экспрессии генов. Предполагаемые сайты-мишени различных членов семейства miR-23 ~ 27 ~ 24 были идентифицированы на основе наличия полной комплементарности семян между положениями 2 и 7 соответствующих miRNA с положительными пиками связывания AGO в базе данных HITS-CLIP ( 23 ). Venny 2.1.0 (bioinfogp.cnb.csic.es/tools/venny) использовался для отображения всех возможных взаимосвязей между различными наборами данных. Данные профилирования экспрессии генов в Т-клетках CD8 + и общих предшественниках ILC были получены из Gene Expression Omnibus (GEO): GSE ( 27 ) и GEO: GSE65850 ( 30 ) соответственно.

    ChIP-Seq анализы человеческих клеток GC-T FH BCL6, h4K4me1, h4K4me3 и h4K27ac данные были получены из GEO GSE59933. Чтобы идентифицировать регуляторную сеть между фактором транскрипции и геном, мы интегрировали эксперименты ChIP-seq и профили модификаций гистонов. Наконец, браузер эпигенома WashU использовался для визуализации общедоступных данных ChIP-seq из ChIP-Atlas (http://chip-atlas.org/) ( 43 ).

    Человеческие лимфатические узлы (LN) и клеточный препарат

    По этическим соображениям, человеческие LN были получены от пациентов с раком головы и шеи, перенесших лимфаденэктомию в качестве диагностической процедуры.Этот проект был рассмотрен и одобрен институциональным наблюдательным советом Медицинского фонда Чанг Гунга (№ 1812210039). Все образцы были получены после информированного согласия. Суспензию мононуклеарных клеток получали сразу после операции путем механического раздавливания образца с использованием скальпеля и матовых предметных стекол для микроскопа с последующим введением шприца через иглу 23-го размера. Все шаги выполнялись на льду. Суспензию клеток промывали холодным PBS (Sigma-Aldrich) с 1% BSA (Sigma-Aldrich), ресуспендировали при 10 7 клеток / мл и использовали для иммуноокрашивания.

    Статистический анализ

    Непарный тест Стьюдента t с 95% доверительным интервалом был выполнен с использованием программного обеспечения Prism (GraphPad). Парный тест Стьюдента t применяли в исследовании SMARTA CD4 + котрансфера Т-клеток. * P <0,05, ** P <0,01 и *** P <0,001 во всех данных.

    ДОПОЛНИТЕЛЬНЫЕ МАТЕРИАЛЫ

    Дополнительные материалы к этой статье доступны по адресу http: //advances.sciencemag.org / cgi / content / full / 5/12 / eaaw1715 / DC1

    Рис. S1. Мыши с Т-клеточно-специфической аблацией семейства miR-23 ~ 27 ~ 24 обнаруживают усиленные Т FH и GC B-клеточные ответы во время аллергической реакции дыхательных путей.

    Рис. S2. Повышение частоты T FH клеток в популяции LCMV-специфических Т-клеток после заражения LCMV.

    Рис. S3. Усиленные LCMV-специфические ответы Ab у мышей с Т-клеточно-специфическим устранением семейства miR-23 ~ 27 ~ 24.

    Рис. S4. Клетки T FH — внутренняя роль семейства miR-23 ~ 27 ~ 24 в регуляции клеточных ответов T FH .

    Рис. S5. Повышенная экспрессия семейства miR-23 ~ 27 ~ 24 в клетках GC-T FH .

    Рис. S6. T reg клеточно-специфическая абляция семейства miR-23 ~ 27 ~ 24 приводила к любому изменению в ответах T FH и GC B клеток на инфекцию LCMV.

    Рис. S7. Повышенная регуляция семейства miR-23 ~ 27 ~ 24 в Т-клетках приводила к снижению клеточных ответов T FH .

    Рис. S8. Наличие отдельных субпопуляций Т-клеток у мышей во время инфекции LCMV.

    Рис. S9. TOX подавлялся miR-23 и miR-27, но не miR-24.

    Рис. S10. Нокдаун TOX приводил к нарушению клеточных ответов T FH .

    Рис. S11. Модуляция количества TOX в Т-клетках не влияла на гомеостаз Т-клеток.

    Рис. S12. Id2 , Icos и Maf не регулируются TOX в клетках T FH .

    Таблица S1. Список генов III: гены значительно активированы в клетках T FH и GC-T FH .

    Таблица S2. Список генов IV: Гены значительно активированы в клетках T FH .

    Таблица S3. Список генов V: гены значительно активированы в клетках GC-T FH .

    Таблица S4. Список генов I. Гены значительно активированы в клетках T-DKO GC-T FH .

    Таблица S5. Список генов II: Гены значительно активированы в клетках T-DKO T FH .

    Таблица S6. miR-23 мишени от HITS-CLIP.

    Таблица S7. miR-24 цели по HITS-CLIP

    Таблица S8.miR-27 мишени от HITS-CLIP.

    Таблица S9. Список генов: общие элементы в «GSE» и «GSE65850».

    Таблица S10. Список праймеров.

    Это статья в открытом доступе, распространяемая в соответствии с условиями некоммерческой лицензии Creative Commons Attribution, которая разрешает использование, распространение и воспроизведение на любом носителе, при условии, что конечным результатом будет , а не для коммерческих целей и при условии, что оригинальная работа правильно процитирована.

    Благодарности: Мы благодарим всех сотрудников нашей лаборатории за обсуждения.Мы благодарим S. Hedrick, A. Goldrath из UCSD и Y. Zheng из Salk Institute за предоставление CD4 Ert2cre Bcl6 fl / fl и мышей SMARTA. Финансирование: Эта работа была поддержана грантами NIH AI089935, AI103646, AI108651 и AI123782 (L.-FL), финансированием Института компьютерной биологии Варшела из города Шэньчжэнь и округа Лунган (H.-YH), Католического университета. Сан-Антонио-де-Мурсия и Фонд Мокси (JCIB), а также грантом Мемориальной больницы Чанг Гун: CMRPD1D0411 ~ 3 (M.-Л.К.). Вклад авторов: Задуманы и разработаны эксперименты: C.-J.W. и Л.-Ф.Л. Выполняли эксперименты: C.-J.W., S.C., C.-H.L., J.R., L.O.C., F.F.d.C., M.-C.C., L.-L.L., L.M.W., J.B. и D.T.U. Проанализированы данные: C.-J.W., S.C., H.-Y.H., S.Q. и L.-F.L. Предоставленные реагенты / материалы / инструменты анализа: H.-Y.H., H.-K.L., N.O.S.C., D.Z., J.C.I.B., L.-C.C., S.-F.H. и M.-L.K. Написали статью: C.-J.W., L.M.W. и L.-F.L. Конкурирующие интересы: Авторы заявляют об отсутствии конкурирующих интересов. Доступность данных и материалов: Авторы заявляют, что данные и материалы, подтверждающие выводы этого исследования, доступны в статье и доступны по обоснованным запросам авторов. В частности, мышей с условными аллелями кластеров miR-23 ~ 27 ~ 24 или мышей, которые избирательно сверхэкспрессируют весь кластер miR-23a (23CTg) или отдельных членов, могут быть предоставлены UCSD в ожидании научного обзора и завершенного соглашения о передаче материала. Запросы на вышеупомянутые линии мыши следует отправлять по адресу: lifanlu {at} ucsd.edu. Данные РНК-секвенирования для различных субпопуляций Т-клеток от мышей T-DKO и однопометников WT доступны из базы данных GEO (GEO GSE118698).

    • Copyright © 2019 Авторы, некоторые права защищены; обладатель исключительной лицензии Американской ассоциации содействия развитию науки. Нет претензий к оригинальным работам правительства США. Распространяется по некоммерческой лицензии Creative Commons Attribution 4.0 (CC BY-NC).

    Проведение серологических тестов, утвержденных EUA

    Об этой странице

    Серологические тесты обнаруживают наличие антител в крови, когда организм реагирует на конкретную инфекцию, например COVID-19.Другими словами, тесты выявляют иммунный ответ организма на инфекцию, вызванную вирусом, а не сам вирус. В первые дни инфекции, когда иммунный ответ организма все еще формируется, антитела могут не обнаруживаться. Это ограничивает эффективность теста для диагностики COVID-19, и это одна из причин, по которой серологические тесты не должны использоваться в качестве единственной основы для диагностики COVID-19. Серологические тесты могут сыграть роль в борьбе с COVID-19, помогая медицинским работникам идентифицировать людей, у которых, возможно, развился иммунный ответ на SARS-CoV-2.Кроме того, эти результаты тестов могут помочь в определении, кто может сдать часть своей крови, называемую плазмой выздоравливающей, которая может служить возможным лечением для тех, кто серьезно болен COVID-19. Однако для правильного использования серологических тестов важно понимать их рабочие характеристики и ограничения. Более того, в настоящее время проводятся исследования для решения вопросов, которые будут лучше информировать о надлежащем использовании этих тестов, например, указывает ли присутствие антител на уровень иммунитета, который может предотвратить или уменьшить тяжесть повторного заражения, а также продолжительность, на которую иммунитет длится.

    Эффективность этих тестов описывается их «чувствительностью» или их способностью идентифицировать тех, у кого есть антитела к SARS-CoV-2 (истинно положительный результат), и их «специфичностью» или их способностью идентифицировать тех, у кого нет антител к SARS. -CoV-2 (истинно отрицательный показатель). Чувствительность теста можно оценить, определив, способен ли он обнаруживать антитела в образцах крови пациентов, у которых подтверждено наличие COVID-19 с помощью теста амплификации нуклеиновых кислот или NAAT.В некоторых валидационных исследованиях этих тестов, таких как тот, который FDA проводит в партнерстве с NIH, CDC и BARDA, использованные образцы, помимо взятых от пациентов, у которых подтверждено наличие COVID-19 с помощью NAAT, также могут быть подтверждены наличие антител с помощью других серологических тестов. Специфичность теста можно оценить путем тестирования большого количества образцов, собранных и замороженных до того, как станет известно о распространении SARS-CoV-2, чтобы продемонстрировать, что тест не дает положительных результатов в ответ на наличие других причин респираторной инфекции, таких как как и другие коронавирусы.

    Эти оценки чувствительности и специфичности являются всего лишь оценками. Они включают 95% доверительные интервалы, которые представляют собой диапазон оценок, в пределах которых мы примерно на 95% уверены, что чувствительность и специфичность теста будут находиться в пределах, учитывая, сколько образцов было использовано при проверке производительности. Чем больше образцов используется для проверки теста, тем меньше становится доверительный интервал, а это означает, что мы можем быть более уверены в предоставленных оценках чувствительности и специфичности.

    Тесты также описываются их положительными и отрицательными прогностическими значениями (PPV и NPV).Эти показатели рассчитываются с использованием чувствительности теста, его специфичности и предположения о процентной доле людей в популяции, у которых есть антитела к SARS-CoV-2 (что в этих расчетах называется «распространенностью»). Каждый тест дает ложноположительные и ложноотрицательные результаты. PPV и NPV помогают тем, кто интерпретирует эти тесты, понять, учитывая, насколько распространены люди с антителами в популяции, насколько вероятно, что человек, получивший положительный результат теста, действительно имеет антитела к SARS-CoV-2 и насколько вероятно, что у человека, получившего отрицательный результат теста, действительно нет антител к SARS-CoV-2.PPV и NPV теста сильно зависят от распространенности того, что этот тест предназначен для обнаружения. Поскольку все тесты будут давать некоторые ложноположительные и некоторые ложноотрицательные результаты, включая тесты, выявляющие антитела к SARS-CoV-2, широкое использование тестов, когда не будет надлежащим образом информироваться другой соответствующей информацией, такой как история болезни или результаты диагностических тестов, может идентифицировать слишком много ложноположительных людей.

    В настоящее время нам неизвестна распространенность людей с положительным результатом на антитела к SARS-CoV-2 в США.Популяция и распространенность S. могут изменяться в зависимости от продолжительности нахождения вируса в стране и эффективности мер по смягчению последствий . Более того, распространенность может широко варьироваться в зависимости от местоположения и между различными группами людей, такими как медицинские работники, из-за разной скорости инфицирования. В группах населения с низкой распространенностью, которые составляют большую часть бессимптомного населения в целом, результат одного теста на антитела вряд ли будет достаточно точным, чтобы принять обоснованное решение относительно того, был ли человек ранее инфицирован или действительно имеет антитела к нему. вирус.Второй тест, обычно оценивающий наличие антител к другому вирусному белку, обычно необходим для повышения точности общих результатов тестирования.

    На этой странице FDA суммировало ожидаемую производительность тестов, которые оно санкционировало, на основе информации, рассмотренной FDA при принятии решения о предоставлении этим тестам разрешения на экстренное использование и предполагая распространенность 5% для расчетов PPV и NPV. Для тестов, в которых проводилось несколько валидационных исследований или когда тесты показали различную эффективность в образцах, собранных в разное время после появления симптомов, эксперты FDA выбрали результаты, которые, по их мнению, наиболее репрезентативны для ожидаемых характеристик теста.Это неполное представление о производительности этих тестов. Всегда обращайтесь к полным инструкциям по использованию, чтобы поместить эти оценки в надлежащий контекст и понять, как использовать и интерпретировать эти тесты. FDA также предоставляет калькулятор, который позволит пользователям увидеть расчетную производительность одного или двух независимых тестов на основе их рабочих характеристик и предполагаемой распространенности антител против SARS-CoV-2 в целевой популяции.

    Производительность теста

    Abbott Alinity i SARS-CoV-2 IgG

    Разработчик: Abbott
    Тест: Alinity i SARS-CoV-2 IgG
    Технология: High Throughput CMIA
    Цель: Nucleocapsid

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 100% (34/34) (89.9%; 100%)
    IgG Специфичность (NPA) 99,0% (99/100) (94,6%; 99,8%)
    IgG PPV при распространенности = 5% 84,0% (46,5%; 96,8%)
    IgG NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Abbott Architect SARS-CoV-2 IgG

    Разработчик: Abbott
    Тест: Architect SARS-CoV-2 IgG
    Технология: High Throughput CMIA
    Цель: Nucleocapsid

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 100% (88/88) (95.8%; 100%)
    IgG Специфичность (NPA) 99,6% (1066/1070) (99,0%; 99,9%)
    IgG PPV при распространенности = 5% 93,4% (84,0%; 97,3%)
    IgG NPV при распространенности = 5% 100% (99,8%; 100%)

    Факты испытаний:


    Abbott Laboratories AdviseDx SARS-CoV-2 IgM (Alinity i)

    Разработчик: Abbott Laboratories Inc.
    Тест: AdviseDx SARS-CoV-2 IgM (Alinity i)
    Технология: Высокая пропускная способность CMIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность (PPA) 95,0% (38/40) (83,5%; 98,6%)
    IgM Специфичность (NPA) 99.6% (2972/2985) (99,3%; 99,7%)
    IgM PPV при распространенности = 5% 92,0% (85,5%; 95,3%)
    IgM NPV при распространенности = 5% 99,7% (99,1%; 99,9%)

    Факты испытаний:


    Abbott Laboratories AdviseDx SARS-CoV-2 IgM (Архитектор)

    Разработчик: Abbott Laboratories Inc.
    Тест: AdviseDx SARS-CoV-2 IgM (Architect)
    Технология: Высокая пропускная способность CMIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность (PPA) 95,0% (38/40) (83,5%; 98,6%)
    IgM Специфичность (NPA) 99.6% (2952/2965) (99,3%; 99,7%)
    IgM PPV при распространенности = 5% 91,9% (85,4%; 95,3%)
    IgM NPV при распространенности = 5% 99,7% (99,1%; 99,9%)

    Факты испытаний:


    Доступ Bio CareStart COVID-19 IgM / IgG

    Разработчик: Access Bio, Inc.
    Тест: CareStart COVID-19 IgM / IgG
    Технология: Боковой поток
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность (PPA) 89.1% (57/64) (79,1%; 94,6%)
    IgM Специфичность (NPA) 99,5% (181/182) (97,0%; 99,9%)
    IgG Чувствительность (PPA) 96,9% (62/64) (89,3%; 99,1%)
    IgG Специфичность (NPA) 99,5% (181/182) (97,0%; 99,9%)
    Комбинированный Чувствительность (PPA) 98.4% (63/64) (91,7%; 99,7%)
    Комбинированный Специфичность (NPA) 98,9% (180/182) (96,1%; 99,7%)
    Комбинированный PPV при распространенности = 5% 82,5% (55,2%; 94,6%)
    Комбинированный NPV при распространенности = 5% 99,9% (99,5%; 100%)

    Факты испытаний:


    Лаборатории ACON ACON SARS-CoV-2 IgG / IgM Быстрый тест

    Разработчик: ACON Laboratories, Inc.
    Тест: ACON SARS-CoV-2 IgG / IgM Rapid Test
    Технология: Боковой поток
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 96,7% (29/30) (83,3%; 99,4%)
    IgM Специфичность 98.8% (79/80) (93,3%; 99,8%)
    IgG Чувствительность 100% (30/30) (88,7%; 100%)
    IgG Специфичность 97,5% (78/80) (91,3%; 99,3%)
    Комбинированный Чувствительность 100% (30/30) (88,7%; 100%)
    Комбинированный Специфичность 96.2% (77/80) (89,5%; 98,7%)
    Комбинированный PPV при распространенности = 5% 58,4% (30,9%; 80,4%)
    Комбинированный NPV при распространенности = 5% 100% (99,3%; 100%)

    Факты испытаний:


    Assure Tech. Устройство для быстрого тестирования на COVID-19 IgG / IgM

    Разработчик: Assure Tech.(Hangzhou Co., Ltd)
    Тест: Assure COVID-19 IgG / IgM Rapid Test Device
    Технология: Боковой поток
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 100% (30/30) (88,7%; 100%)
    IgM Специфичность 98.8% (79/80) (93,3%; 99,8%)
    IgG Чувствительность 90,0% (27/30) (74,4%; 96,5%)
    IgG Специфичность 100% (80/80) (95,4%; 100%)
    Комбинированный Чувствительность 100% (30/30) (88,7%; 100%)
    Комбинированный Специфичность 98.8% (79/80) (93,3%; 99,8%)
    Комбинированный PPV при распространенности = 5% 80,8% (40,9%; 96,0%)
    Комбинированный NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Диагностика Бабсона AC19G1

    Разработчик: Babson Diagnostics, Inc
    Тест: Babson Diagnostics aC19G1
    Технология: High Throughput CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 100% (29/29) (88.3%; 100%)
    IgG Специфичность (NPA) 100% (100/100) (96,3%; 100%)
    IgG PPV при распространенности = 5% 100% (55,7%; 100%)
    IgG NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Beckman Coulter Access SARS-CoV-2 IgG

    Разработчик: Beckman Coulter, Inc.
    Тест: Access SARS-CoV-2 IgG
    Технология: Высокая пропускная способность CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 96,8% (92/95) (91,1%; 98,9%)
    IgG Специфичность (NPA) 99.6% (1395/1400) (99,2%; 99,8%)
    IgG PPV при распространенности = 5% 93,5% (85,2%; 97,2%)
    IgG NPV при распространенности = 5% 99,8% (99,5%; 99,9%)

    Факты испытаний:


    Beckman Coulter Access SARS-CoV-2 IgM

    Разработчик: Beckman Coulter, Inc.
    Тест: Access SARS-CoV-2 IgM
    Технология: Высокая пропускная способность CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность (PPA) 96.7% (146/151) (92,5%; 98,6%)
    IgM Специфичность (NPA) 99,9% (1398/1400) (99,5%; 100%)
    IgM PPV при распространенности = 5% 97,3% (90,4%; 99,3%)
    IgM NPV при распространенности = 5% 99,8% (99,6%; 99,9%)

    Факты испытаний:


    Пекинское предприятие биологической аптеки Вантай WANTAI SARS-CoV-2 Ab ELISA

    Разработчик: Beijing Wantai Biological Pharmacy Enterprise Co., Ltd.
    Тест: WANTAI SARS-CoV-2 Ab ELISA
    Технология: ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность 96,7% (29/30) (83,3%; 99,4%)
    Пан-Иг Специфичность 97.5% (78/80) (91,3%; 99,3%)
    Пан-Иг PPV при распространенности = 5% 67,1% (33,6%; 88,4%)
    Пан-Иг NPV при распространенности = 5% 99,8% (99,0%; 100%)

    Факты испытаний:


    Пекинское предприятие биологической аптеки Вантай WANTAI SARS-CoV-2 Ab Rapid Test

    Разработчик: Beijing Wantai Biological Pharmacy Enterprise Co., Ltd.
    Тест: WANTAI SARS-CoV-2 Ab Rapid Test
    Технология: Боковой поток
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность 100% (30/30) (88,7%; 100%)
    Пан-Иг Специфичность 98.8% (79/80) (93,3%; 99,8%)
    Пан-Иг PPV при распространенности = 5% 80,8% (40,9%; 96,0%)
    Пан-Иг NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Bio-Rad Platelia SARS-CoV-2 Всего Ab

    Разработчик: Bio-Rad Laboratories, Inc
    Тест: Platelia SARS-CoV-2 Total Ab
    Технология: ELISA
    Цель: Nucleocapsid

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 98.0% (49/50) (89,5%; 99,6%)
    Пан-Иг Специфичность (NPA) 99,3% (596/600) (98,3%; 99,7%)
    Пан-Иг PPV при распространенности = 5% 88,6% (73,5%; 95,3%)
    Пан-Иг NPV при распространенности = 5% 99,9% (99,4%; 100%)

    Факты испытаний:


    Biocan Diagnostics Inc.Тест на антитела IgG / IgM к новому коронавирусу (COVID-19) Tell Me Fast

    Разработчик: Biocan Diagnostics Inc.
    Тест: Tell Me Fast New Coronavirus (COVID-19) Тест на антитела IgG / IgM
    Технология: Боковой поток
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 90.0% (27/30) (74,4%; 96,5%)
    IgM Специфичность 98,7% (78/79) (93,2%; 99,8%)
    IgG Чувствительность 93,3% (28/30) (78,7%; 98,2%)
    IgG Специфичность 96,2% (76/79) (89,4%; 98,7%)
    Комбинированный Чувствительность 93.3% (28/30) (78,7%; 98,2%)
    Комбинированный Специфичность 96,2% (76/79) (89,4%; 98,7%)
    Комбинированный PPV при распространенности = 5% 56,4% (28,1%; 79,9%)
    Комбинированный NPV при распространенности = 5% 99,6% (98,8%; 99,9%)

    Факты испытаний:


    Комбинированный тест BioCheck SARS-CoV-2 на IgG и IgM

    Разработчик: BioCheck, Inc.
    Тест: BioCheck SARS-CoV-2, комбинированный тест на IgG и IgM
    Технология: CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность (PPA) 95,5% (105/110) (89,8%; 98,0%)
    IgM Специфичность (NPA) 97.2% (139/143) (93,0%; 98,9%)
    IgG Чувствительность (PPA) 99,1% (109/110) (95,0%; 99,8%)
    IgG Специфичность (NPA) 100% (143/143) (97,4%; 100%)
    Комбинированный Чувствительность (PPA) 99,1% (109/110) (95,0%; 99,8%)
    Комбинированный Специфичность (NPA) 97.2% (139/143) (93,0%; 98,9%)
    Комбинированный PPV при распространенности = 5% 65,1% (41,8%; 82,8%)
    Комбинированный NPV при распространенности = 5% 100% (99,7%; 100%)

    Факты испытаний:


    Набор для тестирования антител IgG BioCheck SARS-CoV-2

    Разработчик: BioCheck, Inc.
    Тест: BioCheck SARS-CoV-2 Набор для проверки антител IgG
    Технология: CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 99.1% (109/110) (95,0%; 99,8%)
    IgG Специфичность (NPA) 100% (143/143) (97,4%; 100%)
    IgG PPV при распространенности = 5% 100% (65,7%; 100%)
    IgG NPV при распространенности = 5% 100% (99,7%; 100%)

    Факты испытаний:


    Набор для тестирования антител IgM BioCheck SARS-CoV-2

    Разработчик: BioCheck, Inc.
    Тест: BioCheck SARS-CoV-2 Набор для тестирования антител IgM
    Технология: CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность (PPA) 95,5% (105/110) (89,8%; 98,0%)
    IgM Специфичность (NPA) 97.2% (139/143) (93,0%; 98,9%)
    IgM PPV при распространенности = 5% 64,2% (40,4%; 82,5%)
    IgM NPV при распространенности = 5% 99,8% (99,4%; 99,9%)

    Факты испытаний:


    Biohit Healthcare (Hefei) Набор для тестирования антител IgM / IgG Biohit SARS-CoV-2

    Разработчик: Biohit Healthcare (Hefei)
    Тест: Biohit SARS-CoV-2 Набор для тестирования антител IgM / IgG
    Технология: Боковой поток
    Цель: Нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 96.7% (29/30) (83,3%; 99,4%)
    IgM Специфичность 95,0% (76/80) (87,8%; 98,0%)
    IgG Чувствительность 96,7% (29/30) (83,3%; 99,4%)
    IgG Специфичность 95,0% (76/80) (87,8%; 98,0%)
    Комбинированный Чувствительность 96.7% (29/30) (83,3%; 99,4%)
    Комбинированный Специфичность 95,0% (76/80) (87,8%; 98,0%)
    Комбинированный PPV при распространенности = 5% 50,4% (26,5%; 72,7%)
    Комбинированный NPV при распространенности = 5% 99,8% (99,0%; 100%)

    Факты испытаний:


    bioMérieux VIDAS SARS-CoV-2 IgG

    Разработчик: bioMérieux SA
    Тест: VIDAS SARS-CoV-2 IgG
    Технология: ELFA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 100% (29/29) (88.3%; 100%)
    IgG Специфичность (NPA) 99,9% (988/989) (99,4%; 100%)
    IgG PPV при распространенности = 5% 98,1% (89,1%; 99,7%)
    IgG NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    bioMérieux VIDAS SARS-CoV-2 IgM

    Разработчик: bioMérieux SA
    Тест: VIDAS SARS-CoV-2 IgM
    Технология: ELFA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность (PPA) 100% (23/23) (85.7%; 100%)
    IgM Специфичность (NPA) 99,4% (306/308) (97,7%; 99,8%)
    IgM PPV при распространенности = 5% 89,0% (65,9%; 96,7%)
    IgM NPV при распространенности = 5% 100% (99,2%; 100%)

    Факты испытаний:


    Экспресс-тест Cellex qSARS-CoV-2 IgG / IgM

    Разработчик: Cellex, Inc.
    Тест: qSARS-CoV-2 IgG / IgM Rapid Test
    Technology: Lateral Flow
    Target: Spike and Nucleocapsid

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Комбинированный Чувствительность (PPA) 93,8% (120/128) (88,2%; 96,8%)
    Комбинированный Специфичность (NPA) 96.0% (240/250) (92,8%; 97,8%)
    Комбинированный PPV при распространенности = 5% 55,2% (39,2%; 70,0%)
    Комбинированный NPV при распространенности = 5% 99,7% (99,3%; 99,8%)

    Факты испытаний:


    ДиаСорин LIAISON SARS-CoV-2 IgM Assay

    Разработчик: DiaSorin, Inc.
    Тест: DiaSorin LIAISON SARS-CoV-2 IgM Assay
    Технология: CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность (PPA) 91.8% (112/122) (85,6%; 95,5%)
    IgM Специфичность (NPA) 99,3% (2455/2473) (98,9%; 99,5%)
    IgM PPV при распространенности = 5% 86,9% (79,7%; 91,6%)
    IgM NPV при распространенности = 5% 99,6% (99,2%; 99,8%)

    Факты испытаний:


    ДиаСорин LIAISON SARS-CoV-2 S1 / S2 IgG

    Разработчик: DiaSorin
    Тест: LIAISON SARS-CoV-2 S1 / S2 IgG
    Технология: High Throughput CMIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 97.6% (40/41) (87,4%; 99,6%)
    IgG Специфичность (NPA) 99,3% (1082/1090) (98,6%; 99,6%)
    IgG PPV при распространенности = 5% 87,5% (76,1%; 93,4%)
    IgG NPV при распространенности = 5% 99,9% (99,3%; 100%)

    Факты испытаний:


    Diazyme Laboratories Diazyme DZ-Lite SARS-CoV-2 IgG Набор CLIA

    Разработчик: Diazyme Laboratories, Inc.
    Тест: Diazyme DZ-Lite SARS-CoV-2 IgG Набор CLIA
    Технология: Высокая производительность CLIA
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 100% (29/29) (88,3%; 100%)
    IgG Специфичность (NPA) 97.4% (830/852) (96,1%; 98,3%)
    IgG PPV при распространенности = 5% 67,1% (54,5%; 75,5%)
    IgG NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Diazyme Laboratories Diazyme DZ-Lite SARS-CoV-2 IgM Набор CLIA

    Разработчик: Diazyme Laboratories, Inc.
    Тест: Diazyme DZ-Lite SARS-CoV-2 IgM Набор CLIA
    Технология: CLIA
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 94,4% (102/108) (88,4%; 97,4%)
    IgG Специфичность (NPA) 98.3% (297/302) (96,2%; 99,3%)
    IgG PPV при распространенности = 5% 75,0% (54,9%; 87,9%)
    IgG NPV при распространенности = 5% 99,7% (99,4%; 99,9%)

    Факты испытаний:


    Emory Medical Laboratories SARS-CoV-2 RBD IgG тест

    Разработчик: Emory Medical Laboratories
    Тест: SARS-CoV-2 RBD IgG test
    Технология: ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 100% (30/30) (88.7%; 100%)
    IgG Специфичность (NPA) 96,4% (615/638) (94,6%; 97,6%)
    IgG PPV при распространенности = 5% 59,3% (46,6%; 68,6%)
    IgG NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    EUROIMMUN SARS-COV-2 ELISA (IgG)

    Разработчик: EUROIMMUN
    Тест: SARS-COV-2 ELISA (IgG)
    Технология: ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность 90.0% (27/30) (74,4%; 96,5%)
    IgG Специфичность 100% (80/80) (95,4%; 100%)
    IgG PPV при распространенности = 5% 100% (46,1%; 100%)
    IgG NPV при распространенности = 5% 99,5% (98,6%; 99,8%)

    Факты испытаний:


    Genalyte Maverick SARS-CoV-2 Мультиантигенная серологическая панель, версия 2

    Разработчик: Genalyte, Inc.
    Тест: Панель мультиантигенной серологии Maverick SARS-CoV-2, версия 2
    Технология: Иммуноанализ с фотонным кольцом (PRI)
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 96,1% (174/181) (92,2%; 98.1%)
    Пан-Иг Специфичность (NPA) 97,7% (842/862) (96,4%; 98,5%)
    Пан-Иг PPV при распространенности = 5% 68,6% (57,7%; 77,4%)
    Пан-Иг NPV при распространенности = 5% 99,8% (99,6%; 99,9%)

    Факты испытаний:


    Набор для обнаружения нейтрализационных антител GenScript cPass SARS-CoV-2

    Разработчик: GenScript USA Inc.
    Тест: cPass SARS-CoV-2 Neutralization Antibody Detection Kit
    Technology: ELISA
    Target: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Ig (нейтрализующий) Чувствительность (PPA) 100% (26/26) (87,1%; 100%)
    Пан-Ig (нейтрализующий) Специфичность (NPA) 100% (88/88) (95.8%; 100%)
    Пан-Ig (нейтрализующий) PPV при распространенности = 5% 100% (52,3%; 100%)
    Пан-Ig (нейтрализующий) NPV при распространенности = 5% 100% (99,3%; 100%)

    Факты испытаний:


    Ханчжоу Biotest Biotech RightSign Кассета для быстрого теста на COVID-19 IgG / IgM

    Разработчик: Hangzhou Biotest Biotech
    Тест: RightSign COVID-19 IgG / IgM Rapid Test Cassette
    Технология: Боковой поток
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 100% (30/30) (88.7%; 100%)
    IgM Специфичность 100% (80/80) (95,4%; 100%)
    IgG Чувствительность 93,3% (28/30) (78,7%; 98,2%)
    IgG Специфичность 100% (80/80) (95,4%; 100%)
    Комбинированный Чувствительность 100% (30/30) (88.7%; 100%)
    Комбинированный Специфичность 100% (80/80) (95,4%; 100%)
    Комбинированный PPV при распространенности = 5% 100% (50,5%; 100%)
    Комбинированный NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Hangzhou Laihe Biotech LYHER New Coronavirus (2019-nCoV) Комбинированный набор антител IgM / IgG (коллоидное золото)

    Разработчик: Hangzhou Laihe Biotech
    Тест: LYHER New Coronavirus (2019-nCoV) Комбинированный набор антител IgM / IgG (коллоидное золото)
    Технология: Боковой поток
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 96.7% (29/30) (83,3%; 99,4%)
    IgM Специфичность 100% (80/80) (95,4%; 100%)
    IgG Чувствительность 100% (30/30) (88,7%; 100%)
    IgG Специфичность 98,8% (79/80) (93,3%; 99,8%)
    Комбинированный Чувствительность 100% (30/30) (88.7%; 100%)
    Комбинированный Специфичность 98,8% (79/80) (93,3%; 99,8%)
    Комбинированный PPV при распространенности = 5% 80,8% (40,9%; 96,0%)
    Комбинированный NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Кассета для быстрого теста Healgen COVID-19 IgG / IgM

    Разработчик: Healgen
    Тест: Кассета для быстрого тестирования COVID-19 IgG / IgM
    Технология: Боковой поток
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 100% (30/30) (88.7%; 100%)
    IgM Специфичность 100% (80/80) (95,4%; 100%)
    IgG Чувствительность 96,7% (29/30) (83,3%; 99,4%)
    IgG Специфичность 97,5% (78/80) (91,3%; 99,3%)
    Комбинированный Чувствительность 100% (30/30) (88.7%; 100%)
    Комбинированный Специфичность 97,5% (78/80) (91,3%; 99,3%)
    Комбинированный PPV при распространенности = 5% 67,8% (35,0%; 88,4%)
    Комбинированный NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    InBios SCoV-2 Обнаружение IgG ELISA

    Разработчик: InBios
    Тест: SCoV-2 Обнаружение IgG ELISA
    Технология: ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность 100% (30/30) (88.7%; 100%)
    IgG Специфичность 100% (80/80) (95,4%; 100%)
    IgG PPV при распространенности = 5% 100% (50,5%; 100%)
    IgG NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    InBios SCoV-2 обнаружение IgM ELISA

    Разработчик: InBios International, Inc.
    Тест: SCoV-2 Определить IgM ELISA
    Технология: ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 96,7% (29/30) (83,3%; 99,4%)
    IgM Специфичность 98.8% (79/80) (93,3%; 99,8%)
    IgM PPV при распространенности = 5% 80,3% (39,4%; 96,0%)
    IgM NPV при распространенности = 5% 99,8% (99,1%; 100%)

    Факты испытаний:


    Innovita (Tangshan) Biological Technology Innovita 2019-nCoV Ab Test (коллоидное золото)

    Разработчик: Innovita (Tangshan) Biological Technology Co., Ltd.
    Тест: Innovita 2019-nCoV Ab Test (коллоидное золото)
    Технология: Боковой поток
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 93,3% (28/30) (78,7%; 98,2%)
    IgM Специфичность 98.8% (79/80) (93,3%; 99,8%)
    IgG Чувствительность 93,3% (28/30) (78,7%; 98,2%)
    IgG Специфичность 98,8% (79/80) (93,3%; 99,8%)
    Комбинированный Чувствительность 100% (30/30) (88,7%; 100%)
    Комбинированный Специфичность 97.5% (78/80) (91,3%; 99,3%)
    Комбинированный PPV при распространенности = 5% 67,8% (35,0%; 88,4%)
    Комбинированный NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Jiangsu Well Biotech Orawell IgM / IgG Быстрый тест

    Разработчик: Jiangsu Well Biotech
    Тест: Orawell IgM / IgG Rapid Test
    Технология: Боковой поток
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 93.1% (54/58) (83,6%; 97,3%)
    IgM Специфичность 95,9% (93/97) (89,9%; 98,4%)
    IgG Чувствительность 100% (58/58) (93,8%; 100%)
    IgG Специфичность 99,0% (96/97) (94,4%; 99,8%)
    Комбинированный Чувствительность 100% (58/58) (93.8%; 100%)
    Комбинированный Специфичность 94,8% (92/97) (88,5%; 97,8%)
    Комбинированный PPV при распространенности = 5% 50,5% (30,0%; 70,3%)
    Комбинированный NPV при распространенности = 5% 100% (99,6%; 100%)

    Факты испытаний:


    Kantaro Biosciences COVID-SeroKlir, Полуколичественный набор антител IgG к SARS-CoV-2 по Кантаро

    Разработчик: Kantaro Biosciences, LLC
    Тест: COVID-SeroKlir, Kantaro Полуколичественный набор антител IgG против SARS-CoV-2
    Технология: Полуколичественный двухэтапный ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 99.1% (233/235) (97,0%; 99,8%)
    IgG Специфичность (NPA) 99,6% (283/284) (98,0%; 99,9%)
    IgG PPV при распространенности = 5% 93,7% (72,2%; 98,8%)
    IgG NPV при распространенности = 5% 100% (99,8%; 100%)

    Факты испытаний:


    Luminex xMAP SARS-CoV-2 Мультиантигенный анализ IgG

    Разработчик: Luminex Corporation
    Тест: xMAP SARS-CoV-2 Multi-Antigen IgG Assay
    Технология: Высокая производительность FMIA
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 96.3% (79/82) (89,8%; 98,7%)
    IgG Специфичность (NPA) 99,3% (599/603) (98,3%; 99,7%)
    IgG PPV при распространенности = 5% 88,4% (73,6%; 95,3%)
    IgG NPV при распространенности = 5% 99,8% (99,5%; 99,9%)

    Факты испытаний:


    Комбинированный набор Megna Health Rapid COVID-19 IgM / IgG

    Разработчик: Megna Health, Inc.
    Тест: Комбинированный набор для быстрого тестирования IgM / IgG на COVID-19
    Технология: Боковой поток
    Цель: Нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 83,3% (25/30) (66,4%; 92,7%)
    IgM Специфичность 97.5% (78/80) (91,3%; 99,3%)
    IgG Чувствительность 100% (30/30) (88,7%; 100%)
    IgG Специфичность 97,5% (78/80) (91,3%; 99,3%)
    Комбинированный Чувствительность 100% (30/30) (88,7%; 100%)
    Комбинированный Специфичность 95.0% (76/80) (87,8%; 98,0%)
    Комбинированный PPV при распространенности = 5% 51,3% (27,7%; 72,9%)
    Комбинированный NPV при распространенности = 5% 100% (99,3%; 100%)

    Факты испытаний:


    Клиническая лаборатория больницы Mount Sinai Тест на антитела к COVID-19 ELISA

    Разработчик: Клиническая лаборатория больницы Mount Sinai
    Тест: Mt.Синайская лаборатория, ELISA, тест на антитела к COVID-19
    Технология: Двухэтапный ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Комбинированный Чувствительность (PPA) 92,5% (37/40) (80,1%; 97,4%)
    Комбинированный Специфичность (NPA) 100% (74/74) (95.1%; 100%)
    Комбинированный PPV при распространенности = 5% 100% (46,1%; 100%)
    Комбинированный NPV при распространенности = 5% 99,6% (98,9%; 99,9%)

    Факты испытаний:


    NanoEntek America FREND COVID-19 всего Ab

    Разработчик: NanoEntek America, Inc.
    Тест: FREND COVID-19 всего Ab
    Технология: FIA
    Цель: Нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    (IgM / IgG) Чувствительность 96.7% (29/30) (83,3%; 99,4%)
    (IgM / IgG) Специфичность 98,8% (79/80) (93,3%; 99,8%)
    (IgM / IgG) PPV при распространенности = 5% 80,3% (39,4%; 96,0%)
    (IgM / IgG) NPV при распространенности = 5% 99,8% (99,1%; 100%)

    Факты испытаний:


    Nirmidas COVID-19 (SARS-CoV-2) Набор для обнаружения антител IgM / IgG

    Разработчик: Nirmidas Biotech, Inc.
    Тест: Nirmidas COVID-19 (SARS-CoV-2) Набор для определения антител IgM / IgG
    Технология: Боковой поток
    Цель: Спайк

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 93,1% (54/58) (83,6%; 97,3%)
    IgM Специфичность 97.9% (95/97) (92,8%; 99,4%)
    IgG Чувствительность 87,9% (51/58) (77,1%; 94,0%)
    IgG Специфичность 100% (97/97) (96,2%; 100%)
    Комбинированный Чувствительность 96,6% (56/58) (88,3%; 99,1%)
    Комбинированный Специфичность 97.9% (95/97) (92,8%; 99,4%)
    Комбинированный PPV при распространенности = 5% 71,1% (39,2%; 90,2%)
    Комбинированный NPV при распространенности = 5% 99,8% (99,3%; 99,9%)

    Факты испытаний:


    Орто-клиническая диагностика Тест VITROS Anti-SARS-CoV-2 IgG

    Разработчик: Ortho-Clinical Diagnostics, Inc.
    Тест: Тест VITROS Anti-SARS-CoV-2 IgG
    Технология: Высокая пропускная способность CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 90,0% (36/40) (76,9%; 96,0%)
    IgG Специфичность (NPA) 100% (407/407) (99.1%; 100%)
    IgG PPV при распространенности = 5% 100% (81,2%; 100%)
    IgG NPV при распространенности = 5% 99,5% (98,8%; 99,8%)

    Факты испытаний:


    Орто-клиническая диагностика VITROS Иммунодиагностические продукты Общая упаковка реагентов и калибратор Anti-SARS-CoV-2

    Разработчик: Ortho-Clinical Diagnostics, Inc.
    Тест: VITROS Immunodiagnostic Products Общий пакет реагентов и калибратор против SARS-CoV-2
    Технология: Высокая производительность CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 100% (49/49) (92,7%; 100%)
    Пан-Иг Специфичность (NPA) 100% (400/400) (99.0%; 100%)
    Пан-Иг PPV при распространенности = 5% 100% (83,7.%; 100%)
    Пан-Иг NPV при распространенности = 5% 100% (99,6%; 100%)

    Факты испытаний:


    Quansys Biosciences Q-Plex SARS-CoV-2 Человеческий IgG (4 Plex)

    Разработчик: Quansys Biosciences, Inc.
    Тест: Q-Plex SARS-CoV-2 Human IgG (4 Plex)
    Технология: CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 95.5% (21/22) (78,2%; 99,2%)
    IgG Специфичность (NPA) 99,7% (583/585) (98,8%; 99,9%)
    IgG PPV при распространенности = 5% 93,6% (76,9%; 98,2%)
    IgG NPV при распространенности = 5% 99,8% (98,9%; 100%)

    Факты испытаний:


    Полуколичественный тест на антитела IgG к SARS-CoV-2 Quanterix Simoa

    Разработчик: Quanterix Corporation
    Тест: Simoa Полуколичественный тест на антитела IgG SARS-CoV-2
    Технология: Полуколичественный сэндвич-ELISA на основе парамагнитных микрогранул
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 100% (28/28) (87.9%; 100%)
    IgG Специфичность (NPA) 99,2% (492/496) (97,9%; 99,7%)
    IgG PPV при распространенности = 5% 86,7% (69,3%; 94,4%)
    IgG NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Журнал Quotient Suisse MosaiQ COVID-19 Antibody Magazine

    Разработчик: Quotient Suisse SA
    Тест: MosaiQ COVID-19 Antibody Magazine
    Технология: Фотометрический иммуноанализ
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 93.0% (80/86) (85,6%; 96,8%)
    Пан-Иг Специфичность (NPA) 99,8% (407/408) (98,6%; 100%)
    Пан-Иг PPV при распространенности = 5% 95,2% (76,6%; 99,2%)
    Пан-Иг NPV при распространенности = 5% 99,6% (99,2%; 99,8%)

    Факты испытаний:


    Roche Elecsys Anti-SARS-CoV-2

    Разработчик: Roche
    Тест: Elecsys Anti-SARS-CoV-2
    Технология: Высокая производительность ECLIA
    Цель: Нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 100% (29/29) (88.3%; 100%)
    Пан-Иг Специфичность (NPA) 99,8% (5262/5272) (99,7%; 99,9%)
    Пан-Иг PPV при распространенности = 5% 96,5% (93,0%; 98,1%)
    Пан-Иг NPV при распространенности = 5% 100% (99,4%; 100%)

    Факты испытаний:


    Roche Elecsys Anti-SARS-CoV-2 S

    Разработчик: Roche Diagnostics, Inc.
    Тест: Elecsys Anti-SARS-CoV-2 S
    Технология: Полуколичественный высокопроизводительный анализ ECLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 96,6% (225/233) (93,4%; 98,3%)
    Пан-Иг Специфичность (NPA) 100% (5990/5991) (99.9%; 100%)
    Пан-Иг PPV при распространенности = 5% 99,7% (98,1%; 99,9%)
    Пан-Иг NPV при распространенности = 5% 99,8% (99,7%; 99,9%)

    Факты испытаний:


    Salofa Oy Sienna-Clarity COVIBLOCK COVID-19 IgG / IgM Кассета для быстрого теста

    Разработчик: Salofa Oy
    Тест: Sienna-Clarity COVIBLOCK COVID-19 Кассета для быстрого тестирования IgG / IgM
    Технология: Боковой поток
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 90.0% (27/30) (74,4%; 96,5%)
    IgM Специфичность 100% (80/80) (95,4%; 100%)
    IgG Чувствительность 93,3% (28/30) (78,7%; 98,2%)
    IgG Специфичность 98,8% (79/80) (93,3%; 99,8%)
    Комбинированный Чувствительность 93.3% (28/30) (78,7%; 98,2%)
    Комбинированный Специфичность 98,8% (79/80) (93,3%; 99,8%)
    Комбинированный PPV при распространенности = 5% 79,7% (38,0%; 95,9%)
    Комбинированный NPV при распространенности = 5% 99,6% (98,8%; 99,9%)

    Факты испытаний:


    Shenzhen New Industries Biomedical Engineering MAGLUMI 2019-nCoV IgM / IgG

    Разработчик: Shenzhen New Industries Biomedical Engineering Co., Ltd.
    Тест: MAGLUMI 2019-nCoV IgM / IgG
    Технология: CLIA
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность (PPA) 77,5% (110/142) (69,9%; 83,6%)
    IgM Специфичность (NPA) 99.6% (225/226) (97,5%; 99,9%)
    IgG Чувствительность (PPA) 100% (142/142) (97,4%; 100%)
    IgG Специфичность (NPA) 99,1% (224/226) (96,8%; 99,8%)
    Комбинированный Чувствительность (PPA) 100% (142/142) (97,4%; 100%)
    Комбинированный Специфичность (NPA) 98.7% (223/226) (96,2%; 99,5%)
    Комбинированный PPV при распространенности = 5% 79,9% (57,2%; 92,1%)
    Комбинированный NPV при распространенности = 5% 100% (99,9%; 100%)

    Факты испытаний:


    Siemens Healthcare Diagnostics ADVIA Centaur SARS-CoV-2 IgG (COV2G)

    Разработчик: Siemens Healthcare Diagnostics
    Тест: ADVIA Centaur SARS-CoV-2 IgG (COV2G)
    Технология: Полуколичественный высокопроизводительный CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 100% (42/42) (91.6%; 100%)
    IgG Специфичность (NPA) 99,9% (1829/1831) (99,6%; 99,9%)
    IgG PPV при распространенности = 5% 98,0% (92,4%; 99,4%)
    IgG NPV при распространенности = 5% 100% (99,6%; 100%)

    Факты испытаний:


    Siemens Healthcare Diagnostics ADVIA Centaur SARS-CoV-2 Total (COV2T)

    Разработчик: Siemens Healthcare Diagnostics
    Тест: ADVIA Centaur SARS-CoV-2 Total (COV2T)
    Технология: High Throughput CMIA
    Target: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 100% (47/47) (92.4%; 100%)
    Пан-Иг Специфичность (NPA) 99,8% (1586/1589) (99,4%; 99,9%)
    Пан-Иг PPV при распространенности = 5% 96,5% (89,8%; 98,8%)
    Пан-Иг NPV при распространенности = 5% 100% (99,6%; 100%)

    Факты испытаний:


    Siemens Healthcare Diagnostics Atellica IM SARS-CoV-2 IgG (COV2G)

    Разработчик: Siemens Healthcare Diagnostics
    Тест: Atellica IM SARS-CoV-2 IgG (COV2G)
    Технология: Полуколичественный высокопроизводительный CLIA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 100% (42/42) (91.6%; 100%)
    IgG Специфичность (NPA) 99,9% (1840/1841) (99,7%; 100%)
    IgG PPV при распространенности = 5% 99,0% (94,0%; 99,8%)
    IgG NPV при распространенности = 5% 100% (99,6%; 100%)

    Факты испытаний:


    Siemens Healthcare Diagnostics Atellica IM SARS-CoV-2 Total (COV2T)

    Разработчик: Siemens Healthcare Diagnostics
    Тест: Atellica IM SARS-CoV-2 Total (COV2T)
    Технология: High Throughput CMIA
    Target: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 100% (42/42) (91.6%; 100%)
    Пан-Иг Специфичность (NPA) 99,8% (1089/1091) (99,3%; 99,9%)
    Пан-Иг PPV при распространенности = 5% 96,6% (87,9%; 99,1%)
    Пан-Иг NPV при распространенности = 5% 100% (99,6%; 100%)

    Факты испытаний:


    Siemens Healthcare Diagnostics Dimension EXL SARS-CoV-2 Общий анализ антител (CV2T)

    Разработчик: Siemens Healthcare Diagnostics
    Тест: Dimension EXL SARS-CoV-2 Общий анализ антител (CV2T)
    Технология: High Throughput ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 100% (79/79) (95.4%; 100%)
    Пан-Иг Специфичность (NPA) 99,9% (1527/1529) (99,5%; 100%)
    Пан-Иг PPV при распространенности = 5% 97,6% (91,3%; 99,3%)
    Пан-Иг NPV при распространенности = 5% 100% (99,8%; 100%)

    Факты испытаний:


    Siemens Healthcare Diagnostics Dimension Vista SARS-CoV-2 Анализ общих антител (COV2T)

    Разработчик: Siemens Healthcare Diagnostics
    Тест: Dimension Vista SARS-CoV-2 Общий анализ антител (COV2T)
    Технология: High Throughput ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 100% (79/79) (95.4%; 100%)
    Пан-Иг Специфичность (NPA) 99,8% (1526/1529) (99,4%; 99,9%)
    Пан-Иг PPV при распространенности = 5% 96,4% (89,7%; 98,7%)
    Пан-Иг NPV при распространенности = 5% 100% (99,8%; 100%)

    Факты испытаний:


    Sugentech SGTi-flex COVID-19 IgG

    Разработчик: Sugentech, Inc.
    Тест: SGTi-flex COVID-19 IgG
    Технология: Боковой поток
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность 96,7% (29/30) (83,3%; 99,4%)
    IgG Специфичность 100% (80/80) (95.4%; 100%)
    IgG PPV при распространенности = 5% 100% (48,9%; 100%)
    IgG NPV при распространенности = 5% 99,8% (99,1%; 100%)

    Факты испытаний:


    TBG Biotechnology TBG SARS-CoV-2 IgG / IgM Набор для быстрого тестирования

    Разработчик: TBG Biotechnology Corp.
    Тест: TBG SARS-CoV-2 IgG / IgM Rapid Test Kit
    Технология: Боковой поток
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 93.3% (28/30) (78,7%; 98,2%)
    IgM Специфичность 95,0% (76/80) (87,8%; 98,0%)
    IgG Чувствительность 93,3% (28/30) (78,7%; 98,2%)
    IgG Специфичность 96,2% (77/80) (89,5%; 98,7%)
    Комбинированный Чувствительность 93.3% (28/30) (78,7%; 98,2%)
    Комбинированный Специфичность 95,0% (76/80) (87,8%; 98,0%)
    Комбинированный PPV при распространенности = 5% 49,6% (25,4%; 72,5%)
    Комбинированный NPV при распространенности = 5% 99,6% (98,7%; 99,9%)

    Факты испытаний:


    Thermo Fisher Scientific OmniPATH COVID-19 Total Antibody Test ELISA Test

    Разработчик: Thermo Fisher Scientific
    Тест: OmniPATH COVID-19 Total Antibody Test ELISA
    Технология: ELISA
    Цель: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность 96.7% (29/30) (83,3%; 99,4%)
    Пан-Иг Специфичность 97,5% (78/80) (91,3%; 99,3%)
    Пан-Иг PPV при распространенности = 5% 67,1% (33,6%; 88,4%)
    Пан-Иг NPV при распространенности = 5% 99,8% (99,0%; 100%)

    Факты испытаний:


    Университет Аризоны, тест на антитела к COVID-19, ELISA, пан-Ig

    Разработчик: University of Arizona Genetics Core for Clinical Services
    Test: COVID-19 ELISA pan-Ig Antibody Test
    Technology: 2-Step ELISA
    Target: Spike

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 97.5% (39/40) (87,1%; 99,6%)
    Пан-Иг Специфичность (NPA) 99,1% (317/320) (97,3%; 99,7%)
    Пан-Иг PPV при распространенности = 5% 84,6% (62,8%; 94,3%)
    Пан-Иг NPV при распространенности = 5% 99,9% (99,3%; 100%)

    Факты испытаний:


    Клинические лаборатории Vibrant America Vibrant COVID-19 Ab Assay

    Разработчик: Vibrant America Clinical Labs
    Тест: Анализ антител на COVID-19
    Технология: Высокая производительность CLIA
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Комбинированный Чувствительность (PPA) 98.1% (52/53) (90,1%; 99,7%)
    Комбинированный Специфичность (NPA) 98,6% (494/501) (97,1%; 99,3%)
    Комбинированный PPV при распространенности = 5% 78,7% (62,4%; 88,6%)
    Комбинированный NPV при распространенности = 5% 99,9% (99,5%; 100,0%)

    Факты испытаний:


    Иммуноанализ микросфер Wadsworth New York SARS-CoV для обнаружения антител

    Разработчик: Wadsworth Center, Департамент здравоохранения штата Нью-Йорк
    Тест: Иммуноанализ в микросфере New York SARS-CoV для обнаружения антител
    Технология: MIA
    Цель: Нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    Пан-Иг Чувствительность (PPA) 88.0% (95/108) (80,5%; 92,8%)
    Пан-Иг Специфичность (NPA) 98,8% (428/433) (97,3%; 99,5%)
    Пан-Иг PPV при распространенности = 5% 80,0% (61,3%; 90,8%)
    Пан-Иг NPV при распространенности = 5% 99,4% (99,0%; 99,6%)

    Факты испытаний:


    Xiamen Biotime Biotechnology BIOTIME SARS-CoV-2 IgG / IgM Быстрый качественный тест

    Разработчик: Xiamen Biotime Biotechnology Co., Ltd.
    Тест: BIOTIME SARS-CoV-2 IgG / IgM Быстрый качественный тест
    Технология: Боковой поток
    Цель: Спайк

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgM Чувствительность 100% (30/30) (88,7%; 100%)
    IgM Специфичность 98.8% (79/80) (93,3%; 99,8%)
    IgG Чувствительность 96,7% (29/30) (83,3%; 99,4%)
    IgG Специфичность 97,5% (78/80) (91,3%; 99,3%)
    Комбинированный Чувствительность 100% (30/30) (88,7%; 100%)
    Комбинированный Специфичность 96.2% (77/80) (89,5%; 98,7%)
    Комбинированный PPV при распространенности = 5% 58,4% (30,9%; 80,4%)
    Комбинированный NPV при распространенности = 5% 100% (99,3%; 100%)

    Факты испытаний:


    ZEUS Scientific ZEUS ELISA SARS-CoV-2 IgG Test System

    Разработчик: ZEUS Scientific, Inc.
    Тест: ZEUS ELISA SARS-CoV-2 IgG Test System
    Технология: ELISA
    Цель: Спайк и нуклеокапсид

    Антитело Показатели эффективности Оценка производительности 95% доверительный интервал
    IgG Чувствительность (PPA) 93,3% (28/30) (78,7%; 98,2%)
    IgG Специфичность (NPA) 100% (70/70) (94.8%; 100%)
    IgG PPV при распространенности = 5% 100% (44,3%; 100%)
    IgG NPV при распространенности = 5% 99,7% (98,8%; 99,9%)

    Факты испытаний:


    Примечание о рассчитанных показателях эффективности:

    В некоторых случаях номера на этой странице и в инструкции по эксплуатации могут незначительно отличаться.Доверительные интервалы для чувствительности и специфичности, представленные на этой странице, были рассчитаны с помощью метода оценки, описанного в CLSI EP12-A2 (2008). См. «Признанные стандарты консенсуса». Доверительные интервалы для PPV и NPV были рассчитаны с использованием значений 95% доверительных интервалов для чувствительности и специфичности.

    Сравнение клинических характеристик и исходов пациентов с гнойным абсцессом печени

  • 1.

    Мартин Г.С., Маннино Д.М., Мосс М. Влияние возраста на развитие и исход сепсиса у взрослых. Crit Care Med. 2006. 34 (1): 15–21.

    Артикул Google ученый

  • 2.

    Chen XC, Yang YF, Wang R, Gou HF, Chen XZ. Эпидемиология и микробиология сепсиса в материковом Китае в первое десятилетие 21 века. Int J Infect Dis. 2015; 31: 9–14.

    CAS Статья Google ученый

  • 3.

    Меддингс Л., Майерс Р.П., Хаббард Дж., Шахин А.А., Лаупланд К.Б., Диксон Э., Гроб С., Каплан Г.Г. Популяционное исследование гнойных абсцессов печени в США: заболеваемость, смертность и временные тенденции. Am J Gastroenterol. 2010. 105 (1): 117–24.

    Артикул Google ученый

  • 4.

    Tsai FC, Huang YT, Chang LY, Wang JT. Пиогенный абсцесс печени как эндемическое заболевание, Тайвань. Emerg Infect Dis. 2008. 14 (10): 1592–600.

    Артикул Google ученый

  • 5.

    Wi JW, Cho EA, Jun CH, Park SY, Park CH, Joo YE, Kim HS, Choi SK, Rew JS, Jung SI. Клиническая характеристика и исходы гнойного абсцесса печени у пожилых корейских пациентов. Корейский J Gastroenterol. 2015; 66 (1): 27–32.

    Артикул Google ученый

  • 6.

    Law ST, Li KK. Пожилой возраст как плохой прогностический признак у больных с гнойным абсцессом печени. Int J Infect Dis. 2013; 17 (3): e177–84.

    Артикул Google ученый

  • 7.

    Chen SC, Lee YT, Yen CH, Lai KC, Jeng LB, Lin DB, Wang PH, Chen CC, Lee MC, Bell WR. Пиогенный абсцесс печени у пожилых людей: клиника, исходы и факторы прогноза. Возраст Старение. 2009; 38 (3): 271–6 обсуждение.

    CAS Статья Google ученый

  • 8.

    Kang SC, Hwang SJ. Влияние пожилого возраста на стационарных больных с гнойным абсцессом печени на Тайване: общенациональный анализ, основанный на утверждениях. J Chin Med Assoc. 2011. 74 (12): 539–43.

    Артикул Google ученый

  • 9.

    Альварес Дж. А., Гонсалес Дж. Дж., Балдонедо РФ, Санс Л., Джунко А., Родрфигес Дж. Л., Мартинес М. Д.. Пиогенные абсцессы печени: сравнение пожилых и молодых пациентов. Е.П.Б. (Оксфорд). 2001. 3 (3): 201–6.

    CAS Статья Google ученый

  • 10.

    Smoger SH, Mitchell CK, McClave SA. Пиогенные абсцессы печени: сравнение пожилых и молодых пациентов.Возраст Старение. 1998. 27 (4): 443–8.

    CAS Статья Google ученый

  • 11.

    Перис Дж., Белло П., Роиг П., Реус С., Карраскоса С., Гонсалес-Алькаид Дж, Палазон Дж. М., Рамос Дж. М.. Клинико-эпидемиологические характеристики гнойного абсцесса печени у людей 65 лет и старше по сравнению с людьми до 65 лет: ретроспективное исследование. BMC Geriatr. 2017; 17 (1): 161.

    Артикул Google ученый

  • 12.

    Zhang J, Du Z, Bi J, Wu Z, Lv Y, Zhang X, Wu R. Влияние предшествующей абдоминальной хирургии на клинические характеристики и прогноз гнойного абсцесса печени: 10-летнее ретроспективное исследование 392 пациентов. Медицина (Балтимор). 2018; 97 (39): e12290.

    Артикул Google ученый

  • 13.

    Кавасаки Т., Чаудри И.Х. Влияние эстрогена на различные органы: терапевтический подход при сепсисе, травмах и реперфузионных повреждениях. Часть 2: печень, кишечник, селезенка и почки.Дж. Анест. 2012; 26 (6): 892–9.

    Артикул Google ученый

  • 14.

    Кавасаки Т., Чаудри И.Х. Влияние эстрогена на различные органы: терапевтический подход при сепсисе, травмах и реперфузионных повреждениях. Часть 1: центральная нервная система, легкие и сердце. Дж. Анест. 2012; 26 (6): 883–91.

    Артикул Google ученый

  • 15.

    Weniger M, Angele MK, Chaudry IH. Роль и использование эстрогенов после травм.Шок. 2016; 46 (3 Suppl 1): 4–11.

    CAS Статья Google ученый

  • 16.

    Кляйн С.Л., Едличка А., Пекош А. X и Y иммунных ответов на вирусные вакцины. Lancet Infect Dis. 2010. 10 (5): 338–49.

    Артикул Google ученый

  • 17.

    Aulock SV, Deininger S, Draing C, Gueinzius K, Dehus O, Hermann C. Гендерные различия в секреции цитокинов при иммунной стимуляции с помощью LPS и LTA.J Interf Cytokine Res. 2006. 26 (12): 887–92.

    Артикул Google ученый

  • 18.

    Couto Dde O, Peixoto Junior AA, Farias JL, Sales Dde B, Lima JP, Rodrigues RS, Meneses FA. Пол и смертность при сепсисе: влияют ли половые гормоны на исход? Rev Bras Ter Intensiva. 2011. 23 (3): 297–303.

    Артикул Google ученый

  • 19.

    Анджеле М.К., Прачке С., Хаббард В.Дж., Чаудри И.Х.Гендерные различия при сепсисе: сердечно-сосудистые и иммунологические аспекты. Вирулентность. 2014; 5 (1): 12–9.

    Артикул Google ученый

  • 20.

    Чоудри М.А., Бланд К.И., Чаудри И.Х. Травма и иммунный ответ — влияние гендерных различий. Травма, повреждение. 2007. 38 (12): 1382–91.

    Артикул Google ученый

  • 21.

    Чоудри М.А., Бланд К.И., Чаудри И.Х. Пол и предрасположенность к сепсису после травмы.Endocr Metab — мишени для лечения иммунных расстройств. 2006. 6 (2): 127–35.

    CAS Статья Google ученый

  • 22.

    Сенер Г, Арбак С, Куртаран П, Гедик Н, Еген БК. Эстроген защищает печень и кишечник у крыс от повреждений, вызванных сепсисом. J Surg Res. 2005. 128 (1): 70–8.

    CAS Статья Google ученый

  • 23.

    Анджеле М.К., Вичманн М.В., Аяла А., Чоффи В.Г., Чаудри И.Х.Блокада рецепторов тестостерона после кровотечения у мужчин. Восстановление ослабленных иммунных функций и улучшение выживаемости после последующего сепсиса. Arch Surg. 1997. 132 (11): 1207–14.

    CAS Статья Google ученый

  • 24.

    Qian Y, Wong CC, Lai S, Chen H, He X, Sun L, Wu J, Zhou J, Yu J, Liu W. и др. Ретроспективное исследование гнойного абсцесса печени с акцентом на Klebsiella pneumoniae в качестве основного патогена в Китае с 1994 по 2015 год.Научный доклад 2016; 6: 38587.

    CAS Статья Google ученый

  • 25.

    Du ZQ, Zhang LN, Lu Q, Ren YF, Lv Y, Liu XM, Zhang XF. Клинические характеристики и исходы гнойных абсцессов печени разного размера: 15-летний опыт работы в одном центре. Научный доклад 2016; 6: 35890.

    CAS Статья Google ученый

  • 26.

    Луо М., Ян ХХ, Тан Б., Чжоу ХР, Ся Х.М., Сюэ Дж., Сюй Х, Цин И, Ли ЧР, Цю Дж. Ф. и др.Распределение распространенных патогенов у пациентов с гнойным абсцессом печени в Китае: метаанализ. Eur J Clin Microbiol Infect Dis. 2016; 35 (10): 1557–65.

    CAS Статья Google ученый

  • 27.

    Келлер Дж.Дж., Цай М.К., Лин К.С., Лин Ю.К., Лин Х.С. Риск инфекций после гнойного абсцесса печени: общенациональное популяционное исследование. Clin Microbiol Infect. 2013; 19 (8): 717–22.

    CAS Статья Google ученый

  • 28.

    Lardiere-Deguelte S, Ragot E, Amroun K, Piardi T, Dokmak S, Bruno O, Appere F, Sibert A, Hoeffel C, Sommacale D, et al. Абсцесс печени: диагностика и лечение.

  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *