Мтз 82 кпп ремонт: Ремонт КПП трактора МТЗ — трансмиссия Беларус

Содержание

Ремонт. Сервис. — «Вескос» — Ремонт трактора МТЗ 132Н МТЗ 320 МТЗ 82 КПП сцепление двигатель стартер

Компания Вескос проводит ремонт и обслуживание тракторов Беларус 320 и МТЗ 82, экскаваторов и минитракторов МТЗ-132Н, Уралец, Foton и других производителей тракторной техники.

У сотрудников компании большой опыт в ремонте вилочных и фронтальных погрузчиков ТСМ, KOMATSU, TOYOTA, МКСМ-800, UNC.

Мы организуем ремонт на своей оборудованной ремонтной базе с эвакуацией техники, а также выезжаем на место поломки техники или проведения технического обслуживания.

 

Расценки на ремонт минитракторов и тракторов МТЗ. Цена ремонта трактора указана в рублях с учетом НДС.

 

Наименование работ МТЗ-132Н МТЗ-320 МТЗ-82
Диагностика 3 000 6 000 6 000
Проведение ТО 7 000
17 000/29 000
17 000/29 000
Стоимость 1 часа работ 2 500 2 500 2 500
Ремонт сцепления 7 000 20 000 20 000
Ремонт КПП 15 000 20 000 20 000
Ремонт ВОМ 5 000 5 000 5 000
Ремонт шарнирной рамы 5 000
Ремонт переднего моста 5 000 10 000 10 000
Ремонт заднего моста 5 000 10 000 10 000
Ремонт тормозов 5 000 5 000
5 000
Ремонт двигателя 10 000 20 000 20 000
Ремонт топливной апп. 3 000 5 000 5 000
Ремонт гидравлики 5 000 5 000 5 000
Ремонт электрики 6 000 6 000 6 000
Шиномонтаж 1 000 2 000 2 000

На все проведенные работы, а также на замененные запчасти гарантия 1 год или 1 200 моточасов.

Расценки на ремонт вилочных погрузчиков.

Цена ремонта вилочного погрузчика указана в рублях с учетом НДС.

Наименование работ до 3 000 кг. до 7 000 кг.
до 15 000 кг.
Диагностика 6 000 10 000 10 000
Проведение ТО 10 000 15 000 25 000
Стоимость 1 часа работ 2 500 2 500 2 500
Ремонт сцепления 10 000 40 000 50 000
Ремонт КПП 10 000 45 000 60 000
Ремонт переднего моста 10 000 20 000 25 000
Ремонт заднего моста 10 000 20 000 30 000
Восстановление управляемого моста 15 000 20 000 30 000
Ремонт тормозов 10 000 12 000 15 000
Ремонт двигателя 20 000 45 000 45 000
Ремонт топливной апп.
10 000 25 000 30 000
Ремонт гидравлики 5 000 15 000 15 000
Ремонт электрики 5 000 10 000 10 000
Шиномонтаж 2 000 3 000 5 000

На все проведенные работы, а также на замененные запчасти гарантия 6 месяцев или 600 моточасов.

7.1.1. МТЗ-80, МТЗ-82. Практическое пособие по текущему ремонту тракторов «Беларусь». Коробка передач. Полная разборка и сборка коробки передач. — «ВАЖНО ВСЕМ»

При обнаружении дефектов шестерен коробку передач разбирают в последовательности, показанной на рис. 2.6.2 — 2.6.30, изношенные детали заменяют.

 

Рис. 2.6.2. Снятие механизма переключения передач:
1 — корпус вилок переключения; 2 — корпус коробки передач; 3 — болт.

 

Рис. 2.6.3. Снятие стопорного кольца промежуточной шестерни понижающего редуктора:
1 — стопорное кольцо; 2 — промежуточная шестерня.

 

Рис. 2.6.4. Выпрессовка промежуточной шестерни понижающего редуктора:
1 — шестерня; 2 — корпус коробки передач; 3 — съемник.

 

Рис. 2.6.5. Снятие стопорного кольца ведомой шестерни понижающего редуктора:
1 — стопорное кольцо; 2 — ведомая шестерня.

 

Рис. 2.6.6. Выпрсссовка стакана первичного вала:
1 — стакан первичного вала; 2 — первичный вал; 3 — технологический болт; 4 — болт.

 

Рис. 2.6.7. Снятие стопорного кольца подшипника первичного вала:
1 — стопорное кольцо; 2 — подшипник; 3 — первичный вал; 4 — стакан первичного вала.

 

Рис. 2.6.8. Выпрессовка первичного вала:
1 — первичный вал; 2 — стакан; 3 — съемник.

 

Рис. 2.6.9. Снятие вилки переключения редуктора:
1 — вилка переключения; 2 — валик переключения.

 

Рис 2.6.l0. Выпрессовка пружинного штифта внутреннего вала:
1 — гнездо внутреннего вала; 2 — корпус коробки передач.

 

Рис 2.6.l1. Выпрессовка внутреннего вала:

1 — гнездо внутреннего вала; 2 — корпус коробки передач.

 

Рис 2.6.l2. Снятие гнезда внутреннего вала и замена шлицевой втулки:
1 — гнездо внутреннего вала; 2 — болт.

 

Рис. 2.6.13. Выпрессовка стакана подшипника ведущей шестерни II ступени редуктора:
1 — стакан; 2 — крыльчатка; 3 — корпус коробки передач; 4 — технологический болт.

 

Рис. 2.6.14. Выпрессовка ведущей шестерни II ступени редуктора из стакана:
1 — шестерня; 2 — стакан; 3 — съемник.

 

Рис. 2.6.15. Выпрессовка подшипника ведущей шестерни II ступени редуктора:
1 — ведущая шестерня.

 

Рис. 2.6.16. Отворачивание гайки крепления внутреннего вала:
1 — гайка; 2 — гнездо подшипника; 3 — корпус коробки передач.

 

Рис. 2.6.17. Выпрессовка промежуточного вала:
1 — промежуточный вал; 2 — корпус коробки передач; 3 — съемник.

 

Рис. 2.6.18. Выпрессовка подшипника промежуточного вала:
1 — подшипник; 2 — гнездо подшипника; 3 — цанга; 4 — инерционный съемник.

 

Рис. 2.6.19. Снятие стопорной планки оси промежуточной шестерни:
1 — стопорная планка; 2 — ось промежуточной шестерни.

 

Рис. 2.6.20. Выпрессовка вала I передачи и заднего хода.

 

Рис. 2.6.21. Спрессовка подшипника с вала I передачи и заднего хода:
1 — подшипник; 2 — вал I передачи и заднего хода; 3 — съемник.

 

Рис. 2.6.22. Снятие ведущей шестерни главной передачи:
1 — ведущая шестерня; 2 — болт.

 

Рис. 2.6.23. Выпрессовка стакана подшипника вторичного вала:
1 — стакан подшипника; 2 — технологический болт.

 

Рис. 2.6.24. Снятие вторичного вала:
1 — вторичный вал; 2 — ведомая шестерня II ступени редуктора.

 

Рис. 2.6.25. Спрессовка внутренней обоймы подшипника со вторичного вала:
1 — внутренняя обойма; 2— вторичный вал; 3 — съемник.

 

Рис. 2.6.26. Выпрессовка подшипника из вторичного вала:
1 — подшипник; 2 — вторичный вал; 3 — цанга; 4 — инерционный съемник.

 

Рис. 2.6.27 Запрессовка внутреннего вала в корпус.

 

Рис. 2.6.28. Наапрессовка промежуточной шестерни понижающего редуктора.

 

Рис. 2.6.29. Запрессовка подшипника во вторичный вал:
1 — подшипник; 2 — вторичный вал; 3 — наставка.

 

Рис. 2.6.30. Напрессовка внутренней обоймы конического подшипника на вторичный вал:
1 — внутренняя обойма подшипника; 2 — вторичный вал; 3 — наставка; 4 — съемник.

Видео Ремонт раздаточной коробки МТЗ-82.1

Трансмиссия трактора МТЗ 82 с полным приводом ходовой части, отличается в своём составе редуктором, обеспечивающим дополнительное распределение крутящего момента для привода переднего моста. Узел присоединён своим корпусом к правому люку картера КПП трактора и именуется раздаточной коробкой. Механизм может подавать мощность на ПВМ в автоматическом и принудительном режимах с возможностью полного отключения привода переднего моста.


Привод переднего моста МТЗ 82

Устройство раздатки

Узел выполнен в отдельном чугунном корпусе в виде одноступенчатого редуктора с цилиндрическими шестернями и обгонной муфтой. Привод механизм получает от вторичного вала коробки передач через промежуточную шестерню, установленную на оси в перегородке КПП. Смазка механизма осуществляется разбрызгиванием масла с общей ёмкости трансмиссии трактора.

раздатка МТЗ 82 в сборе

В состав механизма входит:

  • вал, вращающийся на двух шарикоподшипниках
  • обгонная роликовая муфта свободного хода одностороннего действия, состоящая из наружной и внутренней обойм
  • зубчатая муфта со скользящим блоком для выбора режима работы ПВМ
  • механизм управления, позволяющий отключать — включать и блокировать муфту свободного хода

Обгонная муфта

Наружная обойма 5, являясь ведущей частью муфты, своим внешним зубчатым венцом постоянно находится в зацеплении с промежуточной шестернёй 12 в КПП и получает вращение на всех передачах. Обойма опирается на два подшипника 7 установленных на наружном диаметре ведомой части 6 муфты, которая, в свою очередь, вращается независимо на валу 8 раздаточной коробки, опираясь на латунную втулку. Таким образом, обе обоймы в разблокированном состоянии вращаются независимо друг от друга. В восьми профильных пазах 10 ведущей части муфты находятся блокирующие ролики со штифтами 9 и пружинами 11, которые заперты пробками. Для соединения с зубчатым блоком 2 при переключении режимов работы ПВМ ведущая и ведомая части муфты имеют внутренние зубчатые венцы.


схема устройства раздаточной коробки

Для справки! Номера подшипников раздатки МТЗ 82:

  • на валу со стороны фланцевого хвостовика установлен шарикоподшипник 306К5
  • на валу обратной стороны узла — шарикоподшипник 305А
  • пара одинаковых шариковых подшипников между ведомой и ведущей частями обгонного механизма – 115К5
  • пара роликовых конических подшипников 7306А на оси вращения промежуточной шестерни привода раздатки в КПП

обгонный механизм в сборе

Муфта переключения режимов

Зубчатая муфта представляет собой единый скользящий по шлицам вала зубчатый блок с одноимёнными наружными зубчатыми венцами для взаимодействия с ведомой и ведущей обоймами обгонной муфты. Выбором положения блока определяется режим работы переднего моста. Механизм управления представляет собой систему тяг от рычага управления связанных с осью в корпусе узла, которая передвигает вилку, взаимодействующую через кольцевую выточку в зубчатом блоке.


Зубчатый блок раздатки

Для справки! Раздаточная коробка МТЗ 52 отличается от узла трактора МТЗ 82 отсутствием режима отключения муфты свободного хода. Раздатку МТЗ 82 можно устанавливать на 52-й – наоборот, не рекомендуется.

Раздаточная коробка трактора МТЗ-82

______________________________________________________________________________________________

Рис.81. Раздаточная коробка переднего ведущего моста ПВМ МТЗ-82 1 — пружина; 2 — штифт; 3 – шестерня КПП; 4 – ролик; 5 – вал; 6 — подшипник; 7 – втулка; 8 – подшипник; 9 – шестерня; 10 – ось; 11 – шестерня промежуточная; 12 – гайка; 13 – зубчатая муфта; 14 – фланец; 15 – валик с рычагом; 16 – корпус Раздатка Беларус МТЗ-82 предназначена для передачи крутящего момента от коробки передач к карданному приводу ПВМ. Раздаточная коробка устанавливается на два штифта и крепится болтами к корпусу КПП с правой стороны по ходу трактора. Синхронный привод к раздатке осуществляется от шестерни 3 коробки передач через промежуточную шестерню 11, смонтированную на двух конических роликовых подшипниках на оси 10 в расточке корпуса коробки передач. Подшипники регулируются гайкой 12. Раздаточная коробка Беларус представляет собой одноступенчатый шестеренный редуктор с роликовой муфтой свободного хода и состоит из следующих основных узлов и деталей. Вал 5 смонтирован в корпусе раздатки 16 на шариковых подшипниках. На валу 5 смонтированы: втулка 7 с внутренним зубчатым венцом на игольчатых подшипниках 6, являющаяся внутренней обоймой муфты свободного хода, подвижная зубчатая муфта 13 и фланец 14 для соединения с фланцем промежуточного карданного вала. Шестерня 9 раздаточной коробки, выполненная как одно целое с наружной обоймой муфты свободного хода и внутренним зубчатым венцом для принудительной блокировки, входит в зацепление с промежуточной шестерней 11. Шестерня 9 проворачивается относительно внутренней обоймы муфты свободного хода на двух шариковых подшипниках 8. В профилированных пазах шестерни 9, образующих наружную обойму муфты свободного хода, расположено восемь заклинивающих роликов 4. В рабочее положение для заклинивания каждый ролик устанавливается двумя штифтами 2 под действием спиральных пружин 1. Управление раздаточной коробкой на тракторах МТЗ-82 с унифицированной кабиной Управление зубчатой муфтой 13 осуществляется тягой 4 через рычаги 1 и 7. Направляющая 8 с шариком фиксатора 6 и пружиной 9 устанавливается на тягу 4, имеющую три паза, а палец направляющей 8 устанавливается во втулку кронштейна 5, крепящегося к крышке коробки передач. Рычаг 7 управления приводом ПВМ МТЗ-82.1 имеет три фиксированных положения: — «выключен» — крайнее нижнее (переднее) положение. Отключение муфты свободного хода осуществляется при выводе муфты 13 из зацепления с зубчатым венцом внутренней обоймы 7. Шарик фиксатора при этом находится в верхнем пазу тяги 4. Режим «ПВМ выключен» используйте на транспортных работах при движении по дорогам с твердым покрытием; — «включается и выключается автоматически» — среднее положение. В этом режиме происходит автоматическое включение и выключение ПВМ с помощью муфты свободного хода в зависимости от буксования задних колес. Обеспечивается при соединении зубчатого венца внутренней обоймы 7 с зубчатым венцом муфты 13. Шарик фиксатора при этом находится в среднем пазу тяги 4. При движении трактора вперед без буксования внутренняя обойма муфты свободного хода, жестко связанная с передними колесами, имеет частоту вращения большую, чем наружная обойма. Заклинивания роликов при этом не происходит, крутящий момент на ПВМ не передается. При буксовании задних колес более установленного значения частота вращения внутренней обоймы снижается до тех пор, пока не сравняется с частотой вращения наружной обоймы. Ролики муфты при этом заклиниваются и соединяют в одно целое обе обоймы, обеспечивая передачу крутящего момента на ПВМ. Используйте этот режим при выполнении различных полевых работ. — «включен принудительно» — крайнее верхнее (заднее) положение. Принудительное включение осуществляется зубчатой муфтой 13, которая, перемещаясь по шлицам вала, входит в зацепление с внутренними зубьями шестерни 9 и, соединяя ее непосредственно с валом 5, блокирует муфту свободного хода. Фиксирующий шарик 6 при принудительном включении находится в нижнем пазу тяги 4. Используйте этот режим только в случаях постоянного буксования задних колес и при движении задним ходом, когда требуется подключение переднего ведущего моста. Рис.82. Управление раздаткой привода ПВМ на тракторах Беларус МТЗ-82.1 с унифицированной кабиной 1 — палец; 2 — вилка; 3 — контргайка; 4 — тяга; 5 — кронштейн; 6 – шарик фиксатора; 7 — рычаг; 8 – направляющая; 9 – пружина; 10 – раздаточная коробка; 11 — рычаг. Управление раздаткой на тракторе МТЗ-82 с тент-каркасом на базе малой кабины Управление зубчатой муфтой осуществляется тягой через рукоятку 7 и рычаг 9. Стойка 6, крепиться к полу и имеет три паза, а на тяге 4 имеется упор 5, с помощью которого тяга фиксируется в пазу стойки 6. Рукоятка 7 управления приводом ПВМ имеет три фиксированных положения: — «выключен» — крайнее нижнее положение. Отключение муфты свободного хода осуществляется при выводе муфты из зацепления с зубчатым венцом внутренней обоймы 7. Упор тяги 4 при этом находится в нижнем пазу стойки 6. Режим «ПВМ выключен» используйте на транспортных работах при движении по дорогам с твердым покрытием; — «включается и выключается автоматически» — среднее положение. В этом режиме происходит автоматическое включение и выключение ПВМ с помощью муфты свободного хода в зависимости от буксования задних колес. Обеспечивается при соединении зубчатого венца внутренней обоймы с зубчатым венцом муфты 13. Упор тяги 4 при этом находится в среднем пазу стойки 6. При движении трактора вперед без буксования внутренняя обойма муфты свободного хода, жестко связанная с передними колесами, имеет частоту вращения большую, чем наружная обойма. Заклинивания роликов при этом не происходит, крутящий момент на мост не передается. При буксовании задних колес более установленного значения частота вращения внутренней обоймы снижается до тех пор, пока не сравняется с частотой вращения наружной обоймы. Ролики муфты при этом заклиниваются и соединяют в одно целое обе обоймы, обеспечивая передачу крутящего момента на ПВМ. Используйте этот режим при выполнении различных полевых работ. — «включен принудительно» — крайнее верхнее положение. Принудительное включение осуществляется зубчатой муфтой 13, которая, перемещаясь по шлицам вала, входит в зацепление с внутренними зубьями шестерни 9 и, соединяя ее непосредственно с валом 5, блокирует муфту свободного хода. Упор тяги 4 при принудительном включении находится в верхнем пазу стойки 6. Используйте этот режим только в случаях постоянного буксования задних колес и при движении задним ходом, когда требуется подключение ПВМ. Рис.83. Управление раздаточной коробкой привода ПВМ на тракторе МТЗ-82. 1 с тент-каркасом или основанием тента на базе малой кабины 1 – палец; 2 – вилка; 3 – контргайка; 4 – тяга; 5 – упор; 6 – стойка; 7 – рукоятка; 8 – раздаточная коробка; 9 – рычаг. Регулировка тяги управления раздатки МТЗ-82 — установите рычаг 7 в положение «ПВМ включен принудительно» (верхнее фиксированное положение, шарик фиксатора 6 в нижней лунке «А» тяги 4). — отвинтите контргайку 3 на 2-3 оборота, расшплинтуйте и выньте палец 1. — поверните рычаг 11 по часовой стрелке до полного включения раздаточной коробки 10, т.е. зубчатая муфта находится в зацеплении с наружной и внутренней обоймами муфты свободного хода. — вращая вилку 2, отрегулируйте длину тяги 4 так, чтобы палец свободно входил в отверстия вилки и рычага 11, повернутого по часовой стрелке до упора. — затяните контргайку, установите и зашплинтуйте палец. Регулировка тяги управления раздаткой привода переднего ведущего моста на тракторах с тент-каркасом на базе малой кабины: — установите рукоятку 7 в положение «ПВМ включен принудительно» (верхнее фиксированное положение, упор 5 тяги 4 в верхнем пазу «А» стойки 6). — отвинтите контргайку 3 на 2-3 оборота, расшплинтуйте и выньте палец 1. — поверните рычаг 9 по часовой стрелке до полного включения раздаточной коробки 8, т.е. зубчатая муфта находится в зацеплении с наружной и внутренней обоймами муфты свободного хода. — вращая вилку 2, отрегулируйте длину тяги 4 так, чтобы палец свободно входил в отверстия вилки 2 и рычага 9, повернутого по часовой стрелке до упора. — затяните контргайку 3, установите и зашплинтуйте палец 1.

______________________________________________________________________________________

___________________________________________________________________________________________

Другая спецтехника

МТЗ-80

  • Ходоуменьшитель МТЗ-80, 82
  • Конструкция ходовой части трактора МТЗ-80
  • Коробка переключения передач МТЗ-80
  • Сцепление МТЗ-80, 82
  • Техобслуживание и регулировки КПП МТЗ-80,82
  • Пусковой двигатель ПД-10
  • Раздаточная коробка МТЗ-80
  • Регулировки ведущих мостов МТЗ-80, 82
  • Рулевой механизм и ГУР МТЗ-80, 82
  • Устройство тормозной системы МТЗ-80, 82
  • ВОМ МТЗ-80, 82

______________________________________________________________________________________

ЯМЗ-236

  • Компоненты блока цилиндров ЯМЗ-236 НЕ2, БЕ2
  • Сцепление ЯМЗ-181,182,183
  • Диски сцепления ЯМЗ-236, 238
  • Коленвал и поршневая группа ЯМЗ-236
  • Коробка передач ЯМЗ-236
  • Диагностика и регулировка двигателя ЯМЗ-236
  • Питание топливом и смазка дизеля ЯМЗ-236
  • Сцепление ЯМЗ-236
  • ТНВД и форсунки ЯМЗ-236

ЯМЗ-238

  • Блок цилиндров и поршневая группа ЯМЗ-238
  • Коленчатый вал и ГРМ дизеля ЯМЗ-238
  • КПП ЯМЗ-238
  • Охлаждение и смазка дизеля ЯМЗ-238
  • Сцепление ЯМЗ-238
  • ТНВД ЯМЗ-238

Т-130

  • Бортовые фрикционы Т-130
  • Бортовой редуктор Т-130
  • Дизель Д-160 трактора Т-130
  • Ходовая тележка Т-130
  • Механизм поворота трактора Т-130
  • Сборка и монтаж тележек Т-130
  • Сервомеханизм бортовых фрикционов Т-130
  • Сцепление трактора Т-130
  • Механизм управления муфты сцепления и горным тормозом Т-130

Т-170

  • Двигатель Д-180 бульдозера Т-170
  • Гидросистема бульдозера Т-170
  • Гидроцилиндр бульдозера Т-170, 130
  • Ремонт главной передачи бульдозера Т-170, 130
  • Гусеницы и катки Т-170, 130
  • Несущая и ходовая система Т-170
  • Сборка узлов КПП Т-170, 130
  • Механизм натяжения и опорный каток Т-170, 130
  • Бульдозерное оборудование Т-170 с поворотным отвалом
  • Регулировка муфты сцепления Т-170
  • Детали трансмиссии бульдозера Т-170

КРАЗ

  • Коробка передач КРАЗ-255, 260
  • Рулевое управление Краз-250, 255
  • Ведущий мост и карданные валы Краз-255, 260
  • Сцепление Краз-250, 260
  • ГУР автомобиля Краз
  • Подвески автомобиля Краз
  • Раздаточная коробка Краз
  • Коробка отбора мощности Краз
  • Система тормозов автомобилей Краз-6510, 65055
  • Карданная передача и ведущие мосты Краз-6510, 65055
  • Передняя подвеска автомобилей Краз-6510, 65055
  • Рулевое управление КРАЗ-6510, 65055
  • Сцепление Краз-6510, 65055

Режимы работы

На постоянной основе в условиях грунтовых дорог сельской местности пользуются автоматическим режимом работы включения переднего моста. Для уменьшения износа деталей узла в условиях полевых работ в составе землеобрабатывающих агрегатов — на пахоте, культивации целесообразно пользоваться принудительным режимом работы ПВМ. В условиях постоянного движения по дорогам с твёрдым сухим покрытием рекомендуется отключить привод переднего моста.

Орган управления передним мостом

Рычаг управления находится по правую сторону места водителя и соединён с тягой, проходящей через полик кабины. Рукоятка управления имеет три положения:

  • среднее — включён автоматический режим
  • нижнее — передний мост выключен
  • верхнее — ПВМ включён в принудительном режиме

В поздних версиях трактора управление осуществляется рычагом, в старых изменением положением рукоятки.

Управление приводом ПВМ нового образца


Механизм включения ПВМ старого образца

Автоматическое включение

В автоматическом режиме раздатка передаёт вращение только при возникновении пробуксовки задних ведущих колёс. При этом выбором положения рычага управления, скользящий по шлицам вала блок входит в зацепление своим меньшим зубчатым венцом только с ведомой обоймой обгонной муфты. Это обеспечивает независимое вращение обеих частей обгонной муфты в разблокированном положении. Включение передачи мощности происходит за счёт заклинивания роликов в пазах и соединении обеих обойм при замедлении скорости вращения ведомой обоймы механизма относительно скорости постоянно вращающейся ведущей части муфты раздаточной коробки.


Режимы работы узла

Передаточные числа механизма рассчитаны так, что ведомая обойма роликовой муфты, получая вращение от пассивного перекатывания передних колёс трактора, вращается на 6% быстрее, чем ведущая обойма механизма. Таким образом, при стандартном движении трактора срабатывание муфты не происходит и крутящий момент на передний мост от КПП не передаётся. При естественном замедлении движения передних колёс в результате буксования задних ведущих колёс, передаваемая на ведомую обойму обгонного механизма скорость вращения снижается, а скорость ведущей шестерни остаётся неизменной. В момент уравнивания скоростей вращения обеих частей механизма ролики заходят в клиновые пазы, заставляя вращаться детали как одно целое. С моментом срабатывания мощность передаётся на колёса переднего моста трактора до прекращения буксования задних колёс. Когда скорость вращения ведомой обоймы вырастит за счёт обратного получения вращения от передних колёс — ролики выйдут из пазов и муфта автоматически рассоединится.

Принудительный режим

Включается введением зацепление зубчатого скользящего блока с обеими, внутренними зубчатыми венцами наружной ведущей и внутренней ведомой обойм обгонной муфты. Соединением трёх частей механизма образуется единый жёсткий блок, который принимает вращение от промежуточной шестерни в КПП с последующей передачей через фланцевый хвостовик вала раздатки на карданный привод ПВМ. Такое включение обеспечивает постоянную передачу мощности на передний мост.

Отключение ПВМ

При выборе положения, когда зубчатый блок выходит из зацепления с обеих венцов двух частей обгонной муфты, происходит полное отключение привода ПВМ. При этом ведущая, ведомая части обгонного механизма и зубчатый блок вращаются независимо друг от друга, то есть автоматический и принудительный режимы отключены.

Строение

В состав раздаточной коробки входят следующие важные элементы:

  • ведущий вал;
  • вал, курирующий работу приводов задней, а также передней осей;
  • межосевой дифференциал, который включает блокировочный механизм;
  • передачи: пониженная и цепная (зубчатая).

Остановимся более подробно на функционале и принципах действия каждого узла.

Ведущий вал осуществляет передачу крутящего момента на раздаточную коробку. Здесь уже начинает свою работу межосевой дифференциал. Он осуществляет распределение вращающего момента среди осей, а также отвечает за то, чтобы они непрерывно вращались вне зависимости от углового режима скорости.

Выделяют два вида межосевого дифференциала: симметричный и несимметричный. Функции первого заключаются в том, чтобы вращающий момент между осями был распределен равномерно. Несимметричный дифференциал осуществляет раздачу крутящего момента в необходимом соотношении.

В состав межосевого дифференциала входит блокировочный механизм. Он помогает полностью реализовать возможности полного привода трактора МТЗ. Происходит это за счет предложения частично или полностью выключить дифференциал. В результате обеспечивается устойчивое двустороннее соединение двух осей: передней и задней. Существует два возможных режима блокировки: автоматический и ручной.

Передача цепного типа имеет форму редуктора планетарного вида. Основной ее задачей является усиление вращающего момента в случае поездок по пересеченной местности. В состав цепной передачи входят: приводная цепь, ведомое и ведущее колеса.

Раздаточная коробка может включать не только цепную передачу, но и зубчатую. Основной функцией последней является передача крутящего момента на переднюю ось. Валы ведущей и задней оси по отношению друг к другу размещены соосно. В соответствии со сложившейся ситуацией, например, в случае пробуксовывания передних колес, возможна активация передней оси в нескольких режимах: автоматический, принудительное включение и выключение.

Обслуживание, неполадки и ремонт

Техническое обслуживание узла производится с общим обслуживанием трансмиссии трактора, которое заключается в проверке затяжки всех сочленений корпусов системы и контроле уровня масла. Сезонную замену масла производят на смазку соответствующей вязкости при падении температуры ниже +5°С. Показатель вязкости важен для безотказного срабатывания автоматического режима включения, так как при снижении температуры загустевшее летнее масло будет препятствовать работе обгонного механизма раздаточной коробки.

Не работает автоматический режим

Причинами такой неполадки может быть загрязнение беговых каналов профильных пазов шестерни грязью и продуктами окисления металла. А также вследствие усадки пружин механизма, при недопустимом износе роликов и беговых каналов с пазами, выработки ведомой части муфты.

Часто причиной отказов является появление граней на изношенных роликах. В этом случае осуществляют замену на ролики с увеличенным ремонтным размером для компенсации увеличенных изношенных заклинивающих пазов механизма. Ролики первой комплектации имеют диаметр 15 -0,012 мм, ремонтные 15,15 -0,012 мм.


сборочная схема раздатки

Не работает привод ПВМ

Основной причиной неполадки является появление недопустимых осевых люфтов в результате износа подшипников, а также втулки, на которую посажена ведомая часть муфты. Осевая вибрация выводит из зацепления зубчатую муфту принудительного включения, не позволяя передавать вращение на привод. Для устранения демонтируют узел, производят полную разборку, осуществляют дефектовку и замену вышедших из строя деталей.

Дополнительной причиной плохого включения режимов является нарушение регулировки механизма переключения в результате усадки амортизаторов в креплении кабины и незначительного изменения её положения относительно остова трактора. Нестабильным положением фиксирующей стойки и тяги нарушается амплитуда хода рычагов механизма включения. Для нормальной работы периодически нужно проверять соответствие положений режимов включения и осуществлять регулировку изменением длины тяги с помощью резьбовой муфты.

Часто нарушения в работе раздатки возникают в результате комплекса причин – общего износа и загрязнение механизма, некорректной регулировки механизма включения. Если говорить о нарушении передачи вращения от раздаточной коробки к ПВМ нужно обратить внимание на регулировку и тех.состояние промежуточной опоры привода.

В заключение нужно отметить, что на рабочий ресурс и нормальную работу узла непосредственно влияет состояние сочленений карданной передачи, промежуточной опоры привода, и главной передачи переднего моста. При появлении недопустимых осевых зазоров в опорах вращения узлов привода ПВМ осевое биение будет разбивать подшипники в опорах вала и муфты раздаточной коробки, что приведёт к осевой нестабильности деталей узла и как следствие к невозможности включения режимов работы привода или полному выходу из строя. Поэтому при ремонте любого узла привода ПВМ уделяйте внимание и проверяйте техническое состояние всех частей, начиная с главной передачи ПВМ и заканчивая раздаточной коробкой. Это позволит продлить срок службы всех узлов и деталей привода, положительно отразится на технической готовности к работе, и уменьшит затраты на содержание трактора.


Рис. 2.4.24. Взаимное расположение деталей редуктора конечной передачи трактора МТЗ, запчасти: 1— фланец; 2 — грязевик; 3 — корпус сальника; 4— манжета; 5, 9, 13, 17, 20, 27, 29, 36 — подшипники; 6, 23, 31, 38, 40 — прокладки; 7 — стакан; 8, 32 — кольца; 10, 26 — регулировочные прокладки; 11. 22, 39 — крышки; 12, 37 — шестерни; 14 — шайба; 15 — пластана; 16 — гайка; 18 — вал; 19 — полуось; 21 — регулировочное кольцо; 24, 34 — корпуса; 25 — манжета; 28 — пружина; 30 — труба шкворня; 33 — рычаг; 35 штифт; 41 — гильза

Рис. 2.4.23. Как снять колесо и редуктор конечной передачи трактора МТЗ: 1 — колесо; 2 — болты крепления редуктора; 3 — редуктор конечной передачи Рис. 2.4.25. Как снять крышку редуктора конечной передачи в сборе трактора МТЗ: 1 — крышка редуктора; 2 — корпус редуктора
Рис. 2.4.26. Как снять ведомую шестерню трактора МТЗ: 1 — ведомая шестерня; 2 — крышка редуктора; 3 — подшипник

Рис. 2.4.27. Как спрессовать корпус манжеты трактора МТЗ: 1 — корпус манжеты; 2 — грязевик; 3 — технологический болт; 5 — крышка редуктора

Рис. 2.4.28. Как спрессовать стакан подшипника трактора МТЗ: 1 — стакан подшипника; 2 — корпус редуктора; 3 — технологические болты; 4 — болт

При значительном износе или деструкции манжеты вертикального вала, корпус верхней конической пары колесного редуктора нагревается. Для кучи проблем еще в нем отсутствует смазка.

Если уменьшился ход подвески, снизилась ее жесткость, посмотрите и оцениете упругость пружин. Затруднительный поворот рулевого колеса на поворотах (при условии, что ГУР исправен) возникает из-за того, что опорные подшипники вышли из строя, либо есть заедание телескопических стыков подвески.

Для замены деталей подвески трактора, снимают колесный редуктор. Чтобы сменить гильзы шкворня используют специальные извлекатели. Во время ремонта вышедшие из строя детали заменяют и обращают пристальное внимание на наиболее изнашиваемые поверхности, сверяя с приводимыми в нижней таблице данными.

Размеры деталей подвески ведущего моста трактора МТЗ-82, мм

Внутренний диаметр гильзы шкворня под трубу:
номинальный88+0,035
допустимый88,5
Наружный диаметр трубы вертикального вала под гильзу:
номинальный87 -0.080-0,125
допустимый87,1

Как быть с тем, если у ведущего моста произошло заклинивание колес, появился повышенный шум в корпусе моста, перегрелся стакан подшипников главной передачи, а в масле, которое слили из корпуса моста нашли кучу металлических частиц? Скорее всего, даже наверняка, выработали свой ресурс подшипники ведущей шестерни главной передачи или дифференциала. А еще, такие неисправности получаются при сколах или выкрашивании зубьев конических шестерен главной передачи.

А какие симптомы бывают при выходе из строя частей дифференциала или механизма блокировки? Обратите внимание, что шумы и стуки в корпусе моста при поворотах МТЗ значительно усиливаются, на поворотах происходит блокировка обеих осей колес либо нет блокировки колес при пробуксовании.

Что делать, чтобы определить причины отказов и как устранить неисправности главной передачи и дифференциала трактора? Вначале приподнимают стального коня за передний мост, затем, устанавив на специальные подставки, снимают главную передачу. Следующим шагом будет диагностика ее деталей. Монтажным ломиком, проворачивая ведомую шестерню, осматривают детали дифференциала. Как они взаимно размещены изображено на рис. 2.4.29.


Рис. 2.4.29. Взаимное расположение деталей корпуса, крышки и дифференциала переднего ведущего трактора МТЗ, запчасти: 1 — ось; 2 — корпус; 3 — регулировочные прокладки; 4 — пробка; 5 — подшипник; 6 — обойма сальников; 7 — манжеты; 8, 10 — крышки; 9 — червяк; 11 — коробка дифференциала левая; 12 — ведомый диск; 13 — ведущий диск; 14 — чашка; 15 — шестерня; 16 — сателлит; 17 — оси сателлитов; 18 — коробка дифференциала правая; 19 — ведомая шестерня; 20 — гайка

Иногда при осмотре вскрываются повреждения или износы деталей дифференциала. А еще возникает необходимость в замене шестерни главной передачи. В таком случае дифференциал придется все же снять(рис. 2.4.30).

Как снять дифференциал трактора МТЗ? Для того, чтобы снять дифференциал МТЗ, вначале откручивают болты, стягивающие коробки. Очень важно помнить, что разбирать и изменять взаимное положение коробок дифференциала нежелательно. Для этого вначале их разделения сверяют цифровую маркировку на внешних поверхностях. Если маркировка поблекла или исчезла, ее восстанавливают (рис. 2.4.31—2.4.33).

После того как собрали и разместили дифференциал в корпусе моста, проверяют осевое перемещение ведомой шестерни главной передачи (зазор в подшипниках дифференциала). При сдвиге шестерни в осевом направлении значения отображаемые на индикаторе должны быть в пределах 0,01—0,10 мм.

Следующий этап — регулировка осевого зазора в подшипниках главной передачи (рис. 2.4.34) и дифференциала. Далее главную передачу ставят в корпус моста. В конце всего процесса оценивают и при необходимости корректируют боковой зазор между зубьями конических шестерен (рис. 2.4.35).

Боковой зазор обычно регулируется количеством прокладок, размещенных под стаканом подшипников главной передачи. Если удалить несколько прокладок, то зазор между шестернями уменьшается, а если добавить — увеличивается.

При проведении ремонтных работ, меняя неисправные детали нужно контролировать те поверхности, которые могут изнашиваться сильнее остальных.

Размеры деталей ведущего моста трактора МТЗ-82, мм

НоминальныйДопустимый
Наружный диаметр полуоси и вертикального вала иод подшипник 570735 ± 0,00834,9
Внутренний диаметр корпуса конической пары и трубы вертикального вала под подшипник 5707
-0,010
72,1Внутренний диаметр корпуса редуктора под подшипники:20880,136209К185,14Наружный диаметр ведущей шестерни нижней конической пары под подшипники:20839,936209К144,9Наружный диаметр фланца диска колеса под подшипники:2310К50± 0,00849,9721259,9Внутренний диаметр стакана подшипников фланца диска колеса под подшипник 7212110,1 Рис. 2.4.36. Проверка точности регулировки осевого зазора в подшипниках полуоси или вертикального вала трактора МТЗ: 1 — подшипники; 2 — индикатор Рис. 2.4.37. Установка регулировочных колец трактора МТЗ: 1 — регулировочные кольца; 2 — крышка редуктора конечной передачи

Рис. 2.4.38. Проверка точности регулировки конических подшипников фланца колеса трактора МТЗ: 1 — индикатор; 2, 3 — болты; 4 — труба

Трубу (см. рис. 2.4.38) упирают в торец внутренней обоймы подшипника и подтяжкой болтов 3 регулируют зазор в подшипниках. Поместив индикатор в нужное положение, (см. рис. 2.4.38), затягивают болты 2. Если зазор в подшипниках есть, крышка редуктора со штативом и индикатором поднимется на величину этого зазора.

Чтобы проверить правильность сборки и оценить рабочее состояние зубьев шестерен верхней и нижней конических пар конечной передачи, замеряют еще боковой зазор между зубьями. Зазор определяется по амплитуде перемещения болта крепления диска колеса (рис. 2.4.39).

При закрепленной полуоси, проворачивая диск колеса определяют общий зазор в шестернях конечной передачи. Если более 1,0 мм, измеряют отдельно боковой зазор в зубьях шестерен нижней конической пары. Нужно снять крышку редуктора (рис. 2.4.40), заклинить вертикальный вал и снова измерить.

Рис. 2.4.39. Как измерить боковой зазор между зубьями конических шестерен верхней и нижней конических пар редуктора конечной передачи МТЗ: 1 — редуктор конечной передачи; 2 — болт крепления диска колеса; 3 — индикатор Рис. 2.4.40. Как снять крышку верхней конической пары редуктора конечной передачи трактора МТЗ: 1 — крышка; 2 — болт
Рис. 2.4.41. Регулировка зазора нижней конической пары редуктора конечной передачи трактора МТЗ: 1 — регулировочные прокладки; 2 — фланец колеса Рис. 2.4.42. Регулировка зазора верхней конической пары редуктора конечной передачи трактора МТЗ: 1 — корпус полуоси; 2 — труба шкворня; 3 — регулировочные прокладки

По разнице между первым и последующми замером можно увидеть зазор в зубьях верхней конической пары шестерен. По показаниямм прибора величина зазора в зубьях верхней и нижней пар шестерен должна быть 1,0 мм. При этом условии возможна дальнейшая эксплуатация редуктора трактора без регулировки. А если нужно уменьшить зазор между зубьями нижней комической пары? Для этой цели используют технологические отверстия. Через них выкручивают болты крепления стакана подшипников фланца колеса. Затем двумя монтажными болтами спрессовывают стакан до выхода двух пачек прокладок. Далее необходимое количество прокладок снимают (рис. 2.4.41). При этом толщина оставшихся пачек должна быть одинаковой.

Боковой зазор в нижней конической паре обычно увеличивается из-за выработки или поломки подшипников ведущей шестерни. Чтобы проверить подшипники, отделяют нижнюю крышку и ручным воздействием проворачивают ведущую шестерню в осевом и радиальном направлениях.

Зазор в зубьях шестерен верхней конической нары выставляется так: выкручиваются болты фиксации редуктора и фланца трубы, далее с помощью монтажных болтов выталкивают трубу вертикального вала из корпуса конической пары (рис. 2.4.42).

Снимая часть прокладок, сокращают просвет в зацеплении.

Иногда регулировкой толщины специальных прокладок невозможно получить нужный зазор. Здесь, применяя индикаторное устройство, замеряем осевые передвижения полуоси и вертикального вала. Тем самым узнаем степень затяжки их конических подшипников. Допуск в пределах 0,5 мм. Осевой зазор, скорее всего, получается из-за самоовыкручивания круглых гаек подшипников. Как выставить нужный зазор? Круглые гайки затягивают до предела, а затем откручивают их на 10—15°. Подшипники валов правильно зафиксированы при осевом перемещении валов в пределе 0,05 — 0,15 мм. После настройки валы проворачиваются в подшипниках от усилия руки. Работа по разборке деталей верхней и нижней конических пар продемонстрирована на серии рисунков рис. 2.4.43—2.4.49.

Рис. 2.4.49. Как снять крышку корпуса переднего ведущего моста трактора МТЗ: 1 — крышка; 2 — главная передача

Ремонт пускача МТЗ | Ремонт компрессора трактора

Рекомендации по текущему ремонту тракторов МТЗ-80, МТЗ-50, ЮМЗ-6

Copyright © 2018-2019

Оставить заявку в произвольной форме

Карданный привод трактора Беларус МТЗ-82. 1, 82.2

предназначен для передачи крутящего момента от раздаточной коробки к переднему ведущему мосту.

Карданный привод состоит из двух одинаковых по конструкции и длине карданных валов (промежуточного и переднего) и промежуточной опоры.

Карданный вал состоит

из трубы
12
и двух шарниров с крестовинами
17
на игольчатых подшипниках
13.
Обоймы игольчатых подшипников фиксируются стопорными кольцами
15,
цапфы крестовин снабжены торцовыми уплотнениями
16
и самоподжимными манжетами
14.
Фланцами 18

карданы крепятся к фланцам раздатки, промежуточной опоры
1, 10
и главной пары переднего ведущего моста.

Карданный вал в сборе отбалансирован динамически. Промежуточная опора состоит из регулируемой многодисковой предохранительной фрикционной муфты и подшипникового узла, размещенных в корпусе 7,

который устанавливается на штифтах и крепится болтами к корпусу муфты сцепления снизу.

Крутящий момент от промежуточного кардана передается на фланец 10,

который шлицами соединен с валом
24.
Нажимные диски
20
и ведущие диски
21
установлены на валу
24
и через ведомые диски
22
передают вращение на втулку
5.
Фланец 1,

соединенный шлицами с втулкой
5,
передает крутящий момент через передний карданный вал к переднему ведущему мосту. Сжатие ведущих
21
и ведомых
22
дисков осуществляется через нажимные диски
20
усилием тарельчатых пружин
8.
Муфта регулируется на передачу определенной величины крутящего момента гайкой
11.Карданный привод переднего ведущего моста Беларус МТЗ-82-1, 82-2 с промежуточной опорой

1
– фланец;
2
– кольцо уплотнительное;
3
— корпус манжеты;
4
– манжета;
5
– втулка;
6
— подшипник;
7
– корпус промежуточной опоры;
8
– тарельчатые пружины;
9
– шайба;
10
– фланец;
11
– гайка;
12
– труба карданного вала;
13
– игольчатый подшипник;
14
– манжета;
15
– стопорное кольцо;
16
– торцовое уплотнение;
17
– крестовина;
18
– фланец карданного вала;
19
— прокладка;
20
– нажимной диск;
21
– ведущий диск;
22
– ведомый диск;
23
– втулка,
24
– вал

Компенсация перемещения переднего карданного вала при качании переднего ведущего моста обеспечивается осевым перемещением фланца 1

во втулке
5.
Для предотвращения наматывания на карданные валы соломистых культур при выполнении уборочных работ предусмотрено ограждение.

Раздаточная коробка переднего ведущего моста ПВМ Беларус МТЗ-82.1, 82.2

1
— пружина;
2
— штифт;
3
– шестерня КПП;
4
– ролик;
5
– вал;
6
— подшипник;
7
– втулка;
8
– подшипник;
9
– шестерня;
10
– ось;
11
– шестерня промежуточная;
12
– гайка;
13
– зубчатая муфта;
14
– фланец;
15
– валик с рычагом;
16
– корпус

Раздатка Беларус МТЗ-82.1, 82.2 предназначена для передачи крутящего момента от коробки передач к карданному приводу ПВМ.

Раздаточная коробка устанавливается на два штифта и крепится болтами к корпусу КПП с правой стороны по ходу трактора.

Синхронный привод к раздатке осуществляется от шестерни 3

коробки передач через промежуточную шестерню
11,
смонтированную на двух конических роликовых подшипниках на оси
10
в расточке корпуса коробки передач. Подшипники регулируются гайкой
12.
Раздаточная коробка Беларус МТЗ-82-1, 82-2 представляет собой одноступенчатый шестеренный редуктор с роликовой муфтой свободного хода и состоит из следующих основных узлов и деталей.

Вал 5 смонтирован в корпусе раздатки 16

на шариковых подшипниках. На валу
5
смонтированы: втулка
7
с внутренним зубчатым венцом на игольчатых подшипниках
6,
являющаяся внутренней обоймой муфты свободного хода, подвижная зубчатая муфта
13
и фланец
14
для соединения с фланцем промежуточного карданного вала.

Шестерня 9

раздаточной коробки, выполненная как одно целое с наружной обоймой муфты свободного хода и внутренним зубчатым венцом для принудительной блокировки, входит в зацепление с промежуточной шестерней
11.
Шестерня
9
проворачивается относительно внутренней обоймы муфты свободного хода на двух шариковых подшипниках
8.
В профилированных пазах шестерни 9,

образующих наружную обойму муфты свободного хода, расположено восемь заклинивающих роликов
4.
В рабочее положение для заклинивания каждый ролик устанавливается двумя штифтами
2
под действием спиральных пружин
1.
Управление раздаточной коробкой на тракторах Беларус МТЗ-82.1, 82.2 с унифицированной кабиной

Управление зубчатой муфтой 13

осуществляется тягой
4
через рычаги
1
и
7.
Направляющая
8
с шариком фиксатора
6
и пружиной
9
устанавливается на тягу
4,
имеющую три паза, а палец направляющей
8
устанавливается во втулку кронштейна
5,
крепящегося к крышке коробки передач.

Рычаг 7 управления приводом ПВМ имеет три фиксированных положения:

— «выключен» — крайнее нижнее (переднее) положение. Отключение муфты свободного хода осуществляется при выводе муфты 13

из зацепления с зубчатым венцом внутренней обоймы
7.
Шарик фиксатора при этом находится в верхнем пазу тяги
4.
Режим «ПВМ выключен» используйте на транспортных работах при движении по дорогам с твердым покрытием;

— «включается и выключается автоматически» — среднее положение. В этом режиме происходит автоматическое включение и выключение ПВМ с помощью муфты свободного хода в зависимости от буксования задних колес. Обеспечивается при соединении зубчатого венца внутренней обоймы 7

с зубчатым венцом муфты
13.
Шарик фиксатора при этом находится в среднем пазу тяги
4.
При движении трактора вперед без буксования внутренняя обойма муфты свободного хода, жестко связанная с передними колесами, имеет частоту вращения большую, чем наружная обойма. Заклинивания роликов при этом не происходит, крутящий момент на ПВМ не передается. При буксовании задних колес более установленного значения частота вращения внутренней обоймы снижается до тех пор, пока не сравняется с частотой вращения наружной обоймы. Ролики муфты при этом заклиниваются и соединяют в одно целое обе обоймы, обеспечивая передачу крутящего момента на ПВМ. Используйте этот режим при выполнении различных полевых работ.

— «включен принудительно» — крайнее верхнее (заднее) положение. Принудительное включение осуществляется зубчатой муфтой 13,

которая, перемещаясь по шлицам вала, входит в зацепление с внутренними зубьями шестерни
9
и, соединяя ее непосредственно с валом
5,
блокирует муфту свободного хода. Фиксирующий шарик
6
при принудительном включении находится в нижнем пазу тяги
4.
Используйте этот режим только в случаях постоянного буксования задних колес и при движении задним ходом, когда требуется подключение переднего ведущего моста.

Управление раздаткой привода ПВМ на тракторах Беларус МТЗ-82-1, 82-2 с унифицированной кабиной

1
— палец;
2
— вилка;
3
— контргайка;
4
— тяга;
5
— кронштейн;
6
– шарик фиксатора;
7
— рычаг;
8
– направляющая;
9
– пружина;
10
– раздаточная коробка;
11
— рычаг.

Управление раздаткой на тракторе Беларус МТЗ-82.1, 82.2 с тент-каркасом на базе малой кабины

Управление зубчатой муфтой осуществляется тягой через рукоятку 7

и рычаг
9.
Стойка
6,
крепиться к полу и имеет три паза, а на тяге
4
имеется упор
5,
с помощью которого тяга фиксируется в пазу стойки
6.
Рукоятка 7 управления приводом ПВМ Беларус МТЗ-82-1, 82-2 имеет три фиксированных положения:

— «выключен» — крайнее нижнее положение. Отключение муфты свободного хода осуществляется при выводе муфты из зацепления с зубчатым венцом внутренней обоймы 7.

Упор тяги
4
при этом находится в нижнем пазу стойки
6.
Режим «ПВМ выключен» используйте на транспортных работах при движении по дорогам с твердым покрытием;

— «включается и выключается автоматически» — среднее положение. В этом режиме происходит автоматическое включение и выключение ПВМ с помощью муфты свободного хода в зависимости от буксования задних колес. Обеспечивается при соединении зубчатого венца внутренней обоймы с зубчатым венцом муфты 13.

Упор тяги
4
при этом находится в среднем пазу стойки
6.
При движении трактора вперед без буксования внутренняя обойма муфты свободного хода, жестко связанная с передними колесами, имеет частоту вращения большую, чем наружная обойма. Заклинивания роликов при этом не происходит, крутящий момент на мост не передается. При буксовании задних колес более установленного значения частота вращения внутренней обоймы снижается до тех пор, пока не сравняется с частотой вращения наружной обоймы. Ролики муфты при этом заклиниваются и соединяют в одно целое обе обоймы, обеспечивая передачу крутящего момента на ПВМ. Используйте этот режим при выполнении различных полевых работ.

— «включен принудительно» — крайнее верхнее положение. Принудительное включение осуществляется зубчатой муфтой 13,

которая, перемещаясь по шлицам вала, входит в зацепление с внутренними зубьями шестерни
9
и, соединяя ее непосредственно с валом
5,
блокирует муфту свободного хода. Упор тяги
4
при принудительном включении находится в верхнем пазу стойки
6.
Используйте этот режим только в случаях постоянного буксования задних колес и при движении задним ходом, когда требуется подключение ПВМ.

Управление раздаточной коробкой привода ПВМ на базе малой кабины

1
– палец;
2
– вилка;
3
– контргайка;
4
– тяга;
5
– упор;
6
– стойка;
7
– рукоятка;
8
– раздаточная коробка;
9
– рычаг.

Регулировка тяги управления раздаточной коробкой привода ПВМ Беларус МТЗ-82.1, 82.2:

— установите рычаг 7

в положение «ПВМ включен принудительно» (верхнее фиксированное положение, шарик фиксатора
6
в нижней лунке «А» тяги
4
).

— отвинтите контргайку 3

на 2-3 оборота, расшплинтуйте и выньте палец
1.
— поверните рычаг 11

по часовой стрелке до полного включения раздаточной коробки
10,
т. е. зубчатая муфта находится в зацеплении с наружной и внутренней обоймами муфты свободного хода.

— вращая вилку 2,

отрегулируйте длину тяги
4
так, чтобы палец свободно входил в отверстия вилки и рычага
11,
повернутого по часовой стрелке до упора.

— затяните контргайку, установите и зашплинтуйте палец.

Регулировка тяги управления раздаткой привода переднего ведущего моста на тракторах Беларус МТЗ-82-1, 82-2 с тент-каркасом на базе малой кабины:

— установите рукоятку 7

в положение «ПВМ включен принудительно» (верхнее фиксированное положение, упор
5
тяги
4
в верхнем пазу «А» стойки
6
).

— отвинтите контргайку 3

на 2-3 оборота, расшплинтуйте и выньте палец
1.
— поверните рычаг 9

по часовой стрелке до полного включения раздаточной коробки
8,
т.е. зубчатая муфта находится в зацеплении с наружной и внутренней обоймами муфты свободного хода.

— вращая вилку 2,

отрегулируйте длину тяги
4
так, чтобы палец свободно входил в отверстия вилки
2
и рычага
9,
повернутого по часовой стрелке до упора.

— затяните контргайку 3,

установите и зашплинтуйте палец
1.
Регулировка карданного привода ПВМ

В карданном приводе Беларус МТЗ-82.1, 82.2 производите регулировку предохранительной муфты в промежуточной опоре и проверяйте боковой люфт в подшипниках карданного вала.

Предохранительную муфту регулируйте на передачу крутящего момента от 400 до 800 Нм. Регулировку муфты производите затяжкой гайки заднего хвостовика вала промежуточной опоры до обеспечения передачи требуемого крутящего момента.

Периодически проверяйте боковой люфт в подшипниках крестовин кардана. При наличии люфта разберите шарнир и проверьте состояние подшипников и крестовин, изношенные детали замените. При сборке обоймы сальников запрессовывайте их до упора в подшипник.

Карданный вал динамически отбалансирован. При замене в процессе эксплуатации деталей (трубы с вилками шарнира и фланца) обратитесь к специалистам.

Не проворачивайте карданные валы монтировками, ключами и другими приспособлениями во избежание повреждения уплотнений и выхода из строя подшипников крестовин.

Ремонт — ШСХТ|ШСХТ|

 

АО «Шекснинская Сельхозтехника» осуществляет ремонт всей поставляемой техники, а также узлов и агрегатов.




До ремонта После ремонта








-Ремонт капитальный двигателей Д-240, Д-243, Д-260

-Ремонт КПП МТЗ-82, КПП МТЗ-80, КПП МТЗ-1221

-Ремонт ГУР МТЗ,ГУР ЮМЗ

-Ремонт топливных насосов высокого давления(ТНВД)

-Ремонт переднего моста МТЗ

-Ремонт, регулировка топливных форсунок









  Ремонт капитальный двигателей Д-240,
  Д-243, Д-260

  Ремонт КПП МТЗ-82, КПП МТЗ-80, КПП МТЗ-1221

    Ремонт ГУР МТЗ,ГУР ЮМЗ

  Ремонт топливных насосов высокого давления(ТНВД)

   Ремонт переднего моста МТЗ
 Ремонт, регулировка топливных форсунок

   Ремонт узлов и агрегатов трактора БТЗ (ХТЗ)


 
 

Ремонт, заправка автотракторных кондиционеров.

Ремонт, изготовление шлангов кондиционера.
 

По всем вопросам обращаться к начальнику ТСЦ
Малыгину Дмитрию Викторовичу
Телефон моб. 8-921-2505448
Телефон раб. (81751) 4-22-12
e-mail: [email protected]

Использование методов визуализации для исследования сигналов клеток, индуцированных излучением, на JSTOR

Все большее внимание уделяется использованию подходов системной биологии для определения радиационно-индуцированных реакций в клетках и тканях. Такие подходы часто основываются на глобальном скрининге с использованием различных высокопроизводительных «омиксных» платформ. Хотя эти методы идеальны для получения объективного обзора клеточных ответов, они часто не могут отразить внутреннюю неоднородность системы или предоставить подробную пространственную информацию.Кроме того, выполнение таких исследований с несколькими временными точками отбора проб может быть чрезмерно дорогостоящим. Визуализация представляет собой дополнительный метод с высоким пространственным и временным разрешением, позволяющий отслеживать динамику сигнальных процессов. В этом обзоре мы используем конкретные примеры, чтобы проиллюстрировать, как методы визуализации способствовали нашему пониманию радиационно-индуцированной клеточной передачи сигналов. Особое внимание уделяется колокализации белков, а также колебательной и временной сигнальной динамике.

Radiation Research публикует статьи, посвященные эффектам излучения и связанным с ними темам в областях физики, химии, биологии и медицины, включая эпидемиологию и трансляционные исследования. Термин излучение используется в самом широком смысле и включает, в частности, ионизирующий и ультрафиолетовый, видимый и инфракрасный свет, а также микроволны, ультразвук и тепло. Связанные темы включают (но не ограничиваются ими) исследования с химическими агентами, способствующими пониманию эффектов радиации, изотопных методов, а также методов и приборов дозиметрии.

Общество радиационных исследований преследует три цели: Поощрять самым широким образом продвижение радиационных исследований во всех областях естественных наук; Содействовать совместным исследованиям между дисциплинами физики, химии, биологии и медицины в изучении свойства и эффекты излучения; Содействовать распространению знаний в этих и смежных областях посредством публикаций, встреч и образовательных симпозиумов.

Эпигенетический дрейф, вызванный разрывом ДНК, как причина старения млекопитающих

РЕЗЮМЕ

У млекопитающих существует множество отличительных признаков старения, но объединяющей причины не выявлено.У почкующихся дрожжей старение связано с потерей эпигенетической информации, которая происходит в ответ на нестабильность генома, особенно на двухцепочечные разрывы ДНК (DSB). Млекопитающие также претерпевают предсказуемые эпигенетические изменения с возрастом, включая изменения в паттернах метилирования ДНК, которые служат эпигенетическими «возрастными» часами, но что движет этими изменениями, неизвестно. Используя систему трансгенных мышей под названием «ICE» (для индуцируемых изменений эпигенома), мы показываем, что реакция ткани на немутагенные DSB реорганизует эпигеном и ускоряет физиологические, когнитивные и молекулярные изменения, обычно наблюдаемые у старых мышей, включая развитие эпигенетические часы.Эти данные указывают на то, что эпигенетический дрейф, вызванный DSB, является консервативной причиной старения от дрожжей к млекопитающим.

Краткое содержание одного предложения Разрывы ДНК вызывают эпигеномные изменения, которые ускоряют часы старения у млекопитающих

ВВЕДЕНИЕ

Для того, чтобы клетки поддерживали оптимальную функцию, они должны противодействовать энтропийной потере как генетической, так и эпигенетической информации. Они достигают этого, по крайней мере, в течение некоторого периода времени, потому что они являются открытыми системами, использующими энергию окружающей среды для поддержания генетической и эпигенетической информации, включая последовательность ДНК, транскрипционные сети, модификации хроматина и паттерны метилирования ДНК (DNAme) (Kane и Sinclair, 2019; Keller, 2009).

В 1950-х годах Сциллард и Медавар независимо друг от друга предположили, что старение вызвано потерей генетической информации (Medawar, 1952; Szilard, 1959). С тех пор многочисленные исследования подтверждают эту модель. Например, в клетках старых людей, подвергшихся воздействию окружающей среды, накапливаются многочисленные мутации (Martincorena et al. , 2018; Yizhak et al., 2019), а организмы с дефектами репарации ДНК, по-видимому, подвергаются аспектам ускоренного старения, примером чего являются сегментарные прогероидные расстройства. такие как трихотиодистрофия и синдромы Вернера, Ротмунда-Томпсона и Кокейна (Carrero et al., 2016; Harkema et al., 2016; Park et al., 1999; Sinclair et al., 1997).

Тип повреждения ДНК, который наиболее последовательно связан со старением, — это DSB, особенно токсичная форма повреждения ДНК, которая возникает со скоростью от 10 до 50 на клетку в день (Vilenchik and Knudson, 2003). Недавнее сравнение 18 различных видов грызунов, от мышей до бобров, показало, что из всех процессов репарации ДНК репарация DSB намного сильнее коррелирует с продолжительностью жизни (Tian et al., 2019). Действительно, у мышей дефекты репарации DSB из-за делеции Ku70 , Ku80 или Ercc1 приводят к прогероидным фенотипам (Li et al., 2007; Niedernhofer et al., 2006), в то время как сверхэкспрессия мышиного гена SIRT6, белка репарации DSB, который снижается с возрастом, увеличивает продолжительность жизни мышей (Kaya et al. , 2015; Mao et al., 2011).

Однако в последние годы исследования поставили под сомнение важность мутаций в старении. Количество мутаций у старых дрожжей и в тканях старых мышей относительно невелико, хотя есть исключения, такие как клетки млекопитающих, подвергающиеся воздействию окружающей среды или когда клоны амплифицируются в гематопоэтической системе (Dolle et al., 1997; Kaya et al., 2015). Кроме того, некоторые модифицированные линии мышей с высоким уровнем свободных радикалов или скоростью мутаций практически не демонстрируют признаков преждевременного старения или демонстрируют укороченную продолжительность жизни (Narayanan et al., 1997), в то время как мыши с дефектами репарации ДНК, такие как Ercc2 ( Xpd ) m / m , проявляют прогероидный фенотип, якобы без какого-либо увеличения скорости мутаций (Dolle et al., 2006). Возможно, самым сильным аргументом против потери геномной информации как основной причины старения является тот факт, что можно клонировать животных, таких как собаки, козы, овцы, почти все из которых имеют нормальную, здоровую продолжительность жизни (Burgstaller and Brem, 2017 ).

В 1990-х годах исследования Saccharomyces cerevisiae показали, что старение дрожжей вызвано потерей эпигенетической, а не генетической информации (Kennedy et al., 1997; Sinclair et al., 1997). Считается, что в старых дрожжевых клетках перемещение комплекса регуляторов молчащей информации, отвечающего за NAD + — и CR (Sir2 / 3/4), из локусов типа молчащего спаривания в ядрышко приводит к одновременной экспрессии как a , так и α Информация о типе спаривания, приводящая к стерильности, отличительной чертой старых дрожжевых клеток (Smeal et al., 1996). Во время старения дрожжей также наблюдаются глобальные эпигенетические изменения, включая уменьшение гетерохроматина, эпигенетических регуляторов, измененные модификации гистонов (например, h4K56ac и h5K16ac), гистоновую занятость и увеличение транскрипции генов во всем мире. Тот факт, что модуляция факторов хроматина увеличивает продолжительность жизни дрожжей — например, сверхэкспрессия SIR2 или гистоновых генов, или делеция гена гистонацетилтрансферазы HAT2 или гена гистон-метилтрансферазы SET2 — также указывает на то, что эпигенетические изменения являются причиной старение дрожжей, а не просто биомаркер (Dang et al. , 2009; Feser et al., 2010; Hu et al., 2014; Kaeberlein et al., 1999; Розалены и др., 2005; Ryu et al., 2014).

Многоклеточные организмы также испытывают изменения хроматина и эпигенома во время старения, примеры которых включают глобальное снижение метилирования ДНК и потерю дисбаланса между эухроматином (h4K4me3) и метками гетерохроматина (h4K9me3 и h4K27me3) (Benayoun et al., 2015). ; Pal, Tyler, 2016; Sen et al., 2016). У червей, например, делеция генов комплекса триметилирования h4K4, который катализирует образование эухроматина, увеличивает продолжительность жизни (Greer et al., 2010; Грир и др., 2011). У мух уровни репрессивных меток гетерохроматина, таких как h4K9me2, h4K9me3 и h4K27me3, изменяются в процессе старения (Larson et al., 2012; Ma et al., 2018; Wood et al., 2010), подавление которых ограничением калорийности или сверхэкспрессия dSir2 мух поддерживает молодой эпигеном, подавляет зависящую от возраста экспрессию потенциально вредных мобильных элементов и увеличивает продолжительность жизни (Jiang et al. , 2013; Rogina and Helfand, 2004; Wood et al., 2016). Долгоживущий голый землекоп имеет относительно стабильный эпигеном с повышенным уровнем репрессивных меток по сравнению с мышами (Tan et al., 2017), а у мышей и людей потеря гистонов наблюдается в стареющих клетках (Ivanov et al., 2013; O’Sullivan et al., 2010) и в покоящихся мышечных стволовых клетках (сателлитных клетках) во время старения (Liu et al., 2013). др., 2013).

Некоторые из этих изменений удивительно совпадают между отдельными особями и видами. Например, состояние метилирования выбранных сайтов CpG можно использовать для точного прогнозирования биологического возраста и возможной продолжительности жизни особей широкого круга видов млекопитающих и особей разных видов, утверждая, что лежащий в основе механизм законсервирован (Hannum et al., 2013; Хорват, 2013; Петкович и др., 2017; Weidner et al., 2014).

Вместе эти открытия привели к переходу от рассмотрения старения как случайного процесса к неслучайному и потенциально обусловленному воспроизводимыми и предсказуемыми эпигенетическими изменениями. Но этот сдвиг вызывает новые вопросы. Что заставляет эпигеном млекопитающих меняться с течением времени и как это влияет на старение? И если повреждение ДНК играет роль в старении, как эти, казалось бы, случайные события могут вызывать аналогичные изменения между людьми, создавая впечатление, будто это программа?

Опять же, подсказки пришли из S.cerevisiae . Основным драйвером эпигенетических изменений у дрожжей является DSB, который запускает сигнал повреждения, который привлекает эпигенетические регуляторы от промоторов генов к участку разрыва ДНК, где они помогают в восстановлении, снимая репрессию в повторяющихся локусах, таких как рДНК и теломеры. Примеры таких факторов двойной роли включают Sir2, Hst1, Rpd3, Gcn5 и Esa1 (Martin et al., 1999; McAinsh et al., 1999; Mills et al., 1999; Tamburini and Tyler, 2005). Гипотеза «релокализации модификаторов хроматина» или «RCM», компонент «информационной теории старения» (Kane, Sinclair, 2019; Lu et al., 2019), предполагает, что этот феномен развился как древний ответ на повреждение ДНК, который включает гены реакции на стресс для повышения выживаемости и, в случае дрожжей, предотвращает спаривание до тех пор, пока повреждение не будет устранено, поскольку оно, вероятно, будет летальным (Обердорфер и Синклер, 2007). Согласно модели, большинство факторов репарации ДНК возвращаются на свои исходные участки в геноме после завершения репарации DSB, выключая стрессовую реакцию, но не полностью. При повторных ответах на повреждение ДНК эпигеномный ландшафт постепенно изменяется до такой степени, что клетки остаются в состоянии хронического стресса, что в конечном итоге нарушает их клеточную идентичность.

В настоящее время имеется множество доказательств того, что ОКМ встречается у высших организмов (Kane and Sinclair, 2019). Подобно Sir2 в дрожжах, три из семи гомологов Sir2 млекопитающих, SIRT1, SIRT6 и SIRT7, играют двойную роль в качестве эпигенетических регуляторов и фасилитаторов репарации разрывов ДНК (Mao et al., 2011; Oberdoerffer et al., 2008; Paredes et al. , 2018). Вместе эти гистоновые деацетилазы образуют репрессивный хроматин на теломерах, транспозонах, рДНК и сотнях генов, участвующих в метаболизме, циркадных ритмах, воспалении и восстановлении ДНК, среди прочего (Kawahara et al., 2011; Обердорффер и др. , 2008; Паредес и др., 2018; Саймон и др., 2019; Van Meter et al., 2014). В ответ на сигнал повреждения ДНК, опосредованный ATM, белки RCM перемещаются в сайты DSB, чтобы способствовать восстановлению путем модификации гистонов и привлечения других белков репарации ДНК (Dobbin et al., 2013; Mao et al., 2011; Oberdoerffer et al., 2008; Тойбер и др., 2013). После репарации первоначальный хроматин и эпигенетический статус клеток восстанавливаются, хотя и не полностью, что приводит к появлению информационного шума (O’Hagan et al., 2008). Со временем происходит кумулятивный сдвиг от исходного эпигенетического состояния (Kim et al., 2018). В соответствии с гипотезой RCM сверхэкспрессия SIRT1 или SIRT6 увеличивает стабильность генома, подавляет ретротранспозоны, задерживает транскрипционные изменения с возрастом (Oberdoerffer et al., 2008; Roichman et al., 2016) и, в случае SIRT6, увеличивает продолжительность жизни (Kanfi и др., 2012).

Вместе эти данные указывают на то, что причиной старения эукариот является нарушение регуляции транскрипционных сетей и эпигенетической информации с течением времени, вызванное консервативным механизмом, который эволюционировал для совместной регуляции генетических и эпигенетических реакций на невзгоды (Mills et al. , 1999; Oberdoerffer et al., 2008). Эта идея согласуется с антагонистической плейотропией, согласно которой биологическая система, которая способствует выживанию молодых особей, может быть вредной в более позднем возрасте, когда силы естественного отбора больше не преобладают (Williams, 1957).

Чтобы проверить причинно-следственную связь, в частности, вызывают ли разрывы ДНК эпигенетические изменения, ускоряющие старение у млекопитающего, мы создали трансгенную мышь под названием «ICE» (для индуцируемых изменений эпигенома). Мы обнаружили, что нарушение эпигенома у молодой мыши вызывает старение на молекулярном, гистологическом и физиологическом уровнях, включая ускорение «эпигенетических часов» метилирования ДНК.Эти данные в сочетании с данными нашей сопроводительной статьи, показывающими, что клеточное старение связано с сглаживанием хроматинового ландшафта и потерей клеточной идентичности (см. Янг и др., Совместно представленная рукопись), согласуются с гипотезой о том, что потеря эпигенетической информации является основной причиной старения млекопитающих.

РЕЗУЛЬТАТЫ

Система ICE создает преходящие и немутагенные DSB

Чтобы проверить гипотезу о том, что DSB вызывают эпигенетические изменения, которые способствуют старению, мы разработали и создали мышиную систему, которая позволяет точный временной и пространственный контроль над DSB.DSB создаются в основном в некодирующих областях на частотах, лишь в несколько раз превышающих нормальные фоновые уровни. Для создания немутагенных DSB мы использовали I- Ppo I, самонаводящуюся эндонуклеазу, кодируемую эгоистичным генетическим элементом в слизистой плесени Physarum polycephalum , которая ранее использовалась для изучения репарации DSB в контексте ответа RCM, включая роли ATM, NBS1, SIRT1, SIRT6, HDAC1 и LSD1 (Berkovich et al., 2007; Dobbin et al., 2013; McCord et al., 2009; Мосаммапараст и др., 2013).

I- Ppo I распознает последовательность ДНК CTCTCTTAA ▼ GGTAGC (Monnat et al., 1999), которая встречается 20 раз в геноме мыши, 19 из которых не являются кодирующими, и ни одна из которых не встречается в митохондриальной ДНК ( Беркович и др. , 2007) ( Рисунок S1A и S1B ). Фактическое количество вырезанных сайтов намного меньше, по-видимому, из-за ограниченной доступности ДНК. В отличие от других методов создания DSB, таких как CRISPR, химические вещества и радиация, I- Ppo I создает «липкие концы ДНК», которые восстанавливаются, не вызывая сильного ответа на повреждение ДНК или мутации (Yang et al., совместно поданная рукопись).

Трансгенная система состоит из двух компонентов ( Рисунок 1A ): первый представляет собой слияние гена I- Ppo I с С-концом мутантного гена рецепторного домена эстрогена, регулируемого тамоксифеном (ТАМ) (ER T2 ) и транскрипционная кассета loxP -STOP- loxP , на которую нацелена рекомбиназа Cre (Berkovich et al., 2007; Kim et al., 2016). Второй — это регулируемый тамоксифеном ген рекомбиназы Cre (Cre-ER T2 ) под контролем промотора убиквитина С человека для обеспечения экспрессии во всем организме (Ruzankina et al. , 2007). Когда два компонента объединены in vivo, и тамоксифен присутствует, Cre-ER T2 экспрессируется и направляется в ядро, где он вырезает стоп-кассету, облегчая транскрипцию ER T2 -HA-I- Ppo Кассета гена I-IRES-GFP. Затем белковый продукт ER T2 -I- Ppo I направляется в ядро. После удаления тамоксифена ER T2 -I- Ppo I больше не направляется в ядро ​​и разрушается в цитоплазме.Трансгенных мышей C57BL6 / J, содержащих каждый из этих компонентов, скрещивали с образованием Het ER T2 -I- Ppo I и Cre-ER T2 , названных «индуцируемые изменения эпигенома» или «ICE» мышей, с мышами дикого типа (WT ), Мышей I- Ppo I и Cre, служивших в качестве отрицательного контроля ( Рисунок 1B, ).

Рис. 1. Клеточная система для создания индуцируемых изменений в эпигеноме (ICE)

(A) Схема системы ICE на основе индуцируемой тамоксифеном эндонуклеазы I- Ppo I.

(B) Схема разведения для получения мышей ICE и отрицательных контролей (WT, Cre и I- Ppo I).

(C и D) фокусов γh3AX в DAPI-окрашенных ядрах MEF мышей ICE и контрольных Cre после индукции тамоксифеном (4-OHT, 0,5 мкМ). Масштабная линейка 10 мкм. Двусторонний ANOVA-Бонферрони.

(E) Анализ qPCR разрезания ДНК на канонических сайтах I- Ppo I. Односторонний ANOVA-Бонферрони.

(F) Ответ на повреждение ДНК, индуцированный I- Ppo I (4-OHT, 0,1, 0,5, 1 мкМ) vs.другие агенты, повреждающие ДНК, этопозид (ETS, 1, 10, 25 мкМ) и флеомицин (Phleo, 1, 25, 50 мкг / мл). Шкала шкалы, 10 мкМ. Односторонний ANOVA-Бонферрони.

(G) Вестерн-блоттинг белков, которые участвуют в ответе на повреждение ДНК и ниже его. Блоты, оценивающие p53p и γh3AX, были перепробированы на p53 и h3AX с использованием антител, полученных у разных видов.

(H) Профиль клеточного цикла в клетках Cre и ICE через 96 часов после обработки тамоксифеном.

(I) Процент ассоциированных со старением β-галактозидазоположительных (синие) клеток во время и после лечения тамоксифеном по сравнению с репликативными стареющими клетками. п, отрывок. Односторонний ANOVA-Бонферрони.

(J) Диаметр клеток после восстановления после индукции I- Ppo I по сравнению с облученными (стареющими) клетками. Односторонний ANOVA-Бонферрони.

Данные являются средними (n≥3) ± стандартное отклонение. н.ш .: p> 0,05; * р <0,05; ** p <0,01; *** p <0,001; **** p <0,0001.

Для создания эквивалентной клеточной системы ICE, эмбриональные фибробласты мыши (MEF) выделяли из Iittermates в день E13.5 и культивировали в условиях низкого содержания кислорода (3% об. / Об.). После добавления тамоксифена (0.5 мкМ 4-OHT), HA-I- Ppo I был обнаружен в ядре ( рис. 1C, 1D, S1C и S1D ) и количество фокусов h3AX (γh3AX), фосфорилированных серином 139, маркера DSB. , достигла максимума в 4 раза выше фона в 24-часовой временной точке, при этом степень разрезания зависит от локуса (, рис. 1E, S1E и S1F, ). По сравнению с повреждающим ДНК агентом этопозидом (ингибитор топоизомеразы II) и флеомицином (индуктор свободных радикалов) количество очагов γh3AX, степень разрыва ДНК и реакция на повреждение ДНК в клетках ICE были минимальными (, рис. 1F). -J и S1G ).В течение 24 часов индукции I- Ppo I не было обнаруженных изменений в профиле клеточного цикла, старении или количестве анеуплоидных клеток ( Рисунок 1H-1J и S1H ). В рДНК 28S не было изменений в частоте мутаций, уровнях РНК или общей эффективности трансляции в обработанных клетках ICE (, фиг. S2A-S2H) .

Рисунок S1. Система ICE на основе клеток не вызывает нестабильность генома, что связано с рис. 1

(A) Canonical I- Ppo I нацелено на геном мыши.

(B) Геномное распределение канонических мишеней I- Ppo I.

(C) ПЦР-анализ удаления кассеты STOP во время лечения 4-OHT.

(D) Количественная оценка индукции очагов γh3AX во время лечения 4-OHT и после лечения.

(E) In vitro разрезание ПЦР-амплифицированных мишеней I- Ppo I с использованием очищенного I- Ppo I.

(F) Анализ иммунопреципитации хроматина (ChIP) осаждения γh3AX на I- Ppo Я нацелен на сайты. Односторонний ANOVA-Бонферрони.

(G) Электрофорез одиночных клеток MEF после обработки камптотецином (CPT, 25 мкг / мл), этопозидом (ETS, 10 мкМ), пероксидом водорода (H 2 O 2 , 100 мкМ) или I- Ppo I индукция (4-OHT, 1 мкМ). Односторонний ANOVA-Бонферрони.

(I) Процент клеток с аберрантными метафазными хромосомами. Двусторонний тест Студента t . Данные являются средними (n = 2-3) ± SEM. н.ш .: p> 0,05; * р <0,05; ** p <0,01; *** р <0,001.

Рисунок S2.Клеточная система ICE не вызывает мутаций в рДНК, что связано с рис. 1.

(A) Саузерн-блот 28S рДНК во время обработки 4-OHT и после обработки.

(B) In vitro разрезание I- Ppo I нацелено на ПЦР-амплификацию геномной ДНК из постобработанных клеток ICE.

(C) Surveyor-нуклеазный анализ мишеней I- Ppo I в постобработанных клетках ICE. Фрагмент ПЦР с точечной мутацией (Cre PM) в сайте I- Ppo I служил положительным контролем.

(D) Частота мутаций 28S рДНК в постобработанных клетках ICE. Двусторонний тест Студента t .

(E) Уровень 28S рРНК в постобработанных клетках ICE. Двусторонний тест Студента t .

(G) Биоанализатор отслеживает 28S и 18S рРНК в постобработанных клетках ICE.

(G) Соотношение 28S: 18S рРНК. Двусторонний тест Студента t .

(H) Трансляция белка в клетках ICE после обработки, оцененная по метаболическому 35 S-мечения. Двусторонний тест Студента t .

Данные являются средними (n≥3) ± стандартное отклонение. н.с.: p> 0,05.

Система ICE вызывает немутагенные порезы

In vivo

Для тестирования системы ICE in vivo мы провели индукцию всего тела I- Ppo I в течение трех недель у мышей в возрасте 4-6 месяцев с помощью предоставление модифицированной очищенной диеты для грызунов AIN-93G, содержащей цитрат тамоксифена (360 мг / кг), и наблюдение за мышами в течение еще 10 месяцев. Если не указано иное, все эксперименты проводились в соответствии с этим экспериментальным графиком (, рис. 2A, ).Степень удаления кассеты STOP была аналогичной в мышцах (67%), печени (71%), гиппокампе (61%) и коре (72%) ( Рисунок 2B ) и HA-I- Ppo I, γh3AX и eGFP были обнаружены во время лечения тамоксифеном во всех протестированных тканях (, рис. 2C и 2D, ).

Рисунок 2. Проверка ICE Mouse

(A) График времени индукции I- Ppo I и фенотипическая оценка мышей.

(B) Удаление кассеты транскрипции STOP в основных тканях.Односторонний ANOVA-Бонферрони.

(C) Вестерн-блоттинг тканей, зондированных анти-HA для обнаружения экспрессии I- Ppo I и γh3AX после 4-недельного лечения тамоксифеном.

(D) Срезы гиппокампа, иммуноокрашенные на GFP (в качестве заместителя для IRES-связанной экспрессии I- Ppo I) и γh3AX. Масштабная линейка, 200 мкм (10X) и 50 мкм (40X).

(E и F) Иммунопреципитация и количественная оценка участков разреза I- Ppo I в скелетных мышцах во время и после лечения тамоксифеном (0 по сравнению с 1 месяцем после лечения). Двусторонний тест Студента t .

(G) Трансляция белков в головном мозге и скелетных мышцах, оцененная с помощью метаболического 35 S-мечения. Двусторонний тест Студента t .

(H) Секвенирование полного генома (> 50x) 19 канонических сайтов узнавания I- Ppo I в скелетных мышцах через 1 месяц после прекращения индукции I- Ppo I.

Данные являются средними (n≥3) ± SEM. н.ш .: p> 0,05; * р <0,05; ** p <0,01; *** p <0,001; **** p <0.0001.

Для оценки местоположения и степени разрезания I- Ppo I мы адаптировали анализ КПЦР с захватом конца (Chailleux et al., 2014), в котором используется биотинилированный олигонуклеотид, несущий выступающий 5′-TTAA-3 ‘ для осаждения концов ДНК, полученных в результате разреза I- Ppo I (, рис. 2E, ). В скелетных мышцах, ткани, хорошо изученной во время старения, участок интрона Tmem56 (Chr3: 121249934-121249948) был разрезан примерно в 25 раз менее эффективно по сравнению с очищенной ДНК и не определялся через 1 месяц после удаления тамоксифена. Интересно, что разрез на сайте 28S не был обнаружен во время и после лечения, предположительно из-за недоступности ( Рисунок 2F, ), и не было изменений в уровнях 28S рРНК или общем синтезе белка ( Рисунок 2G, S3A и S3B ). Длина теломер существенно не различалась между тканями Cre и ICE через 10 месяцев после лечения (рис. , S3C ), и не было обнаружено различий в частоте мутаций в икроножной мышце при секвенировании всего генома через 1 месяц после лечения, как при каноническом, так и не каноническом уровне. -канонические сайты узнавания I- Ppo I или по всему геному (Wittmayer et al., 1998) ( Рисунок 2H, S3D и S3E ). Вместе эти данные показывают, что система ICE способна индуцировать специфические разрывы ДНК, которые полностью восстанавливаются и не вызывают явных эффектов на мышей во время индукции тамоксифена (Yang et al., Совместно представленная рукопись).

Рисунок S3. Отсутствие изменений в 28S рДНК или длине теломер в мышцах ICE после обработки, относящихся к фиг. 2

(A) Число копий 28S рДНК, оцененное с помощью монохромной мультиплексной количественной ПЦР (MMQPCR). Двусторонний ANOVA-Бонферрони.

(B) Уровни 28S рРНК.Двусторонний ANOVA-Бонферрони.

(C) Длина теломер оценивается с помощью монохромной мультиплексной количественной ПЦР (MMQPCR). Двусторонний ANOVA-Бонферрони.

(D и E) Процент немутантных последовательностей в неканонических сайтах I- Ppo I или ~ 100 000 случайных сайтов при глубоком секвенировании (> 50x) в мышцах после 1-месячного ICE.

Данные являются средними ± SEM. н.с.: p> 0,05.

Не мутагенные фенокопии, связанные с расслоением ДНК Физиологические изменения, связанные с возрастом

С возрастом мыши претерпевают характерные физические и физиологические изменения, включая алопецию, поседение волос, кифоз, снижение массы тела, снижение подвижности в темноте и снижение дыхания в течение дня, поскольку в качестве источника энергии они используют жир, а не углеводы (Ackert-Bicknell et al. , 2015; Harkema et al., 2016; Houtkooper et al., 2011; Кокс и др., 2016). Если гипотеза RCM верна, короткий период индукции I- Ppo I должен внести эпигеномный шум и ускорить некоторые, если не все, из этих изменений. Чтобы проверить это, мы поместили когорты мышей ICE в возрасте 4-6 месяцев на диету, содержащую тамоксифен, в течение трех недель и оценили их в течение еще 10 месяцев (, рис. 3A, ) с идентично обработанными WT, Cre и I- . Ppo I контрольные группы однопометников, служащие отрицательными контролями.В течение трех недель индукции I- Ppo I не было обнаружено различий между мышами ICE и контрольной группой с точки зрения поведения, активности или приема пищи. Однако через месяц у мышей ICE наблюдались визуальные различия по сравнению с контрольной группой, такие как легкая алопеция и потеря пигмента на лапах, хвосте, ушах и носу, общие черты мышей WT среднего возраста (Liu et al., 2019; Nishimura et al., 2005) ( Рисунок 3B и S4K ).

Рисунок S4. Фенокопия мышей ICE. Нормальное старение, связанное с рисунком 3

(A) Масса тела самок мышей Cre и ICE через 10 месяцев после лечения.Однофакторный дисперсионный анализ с повторными измерениями.

(B) Потребление пищи мышами Cre и ICE, подвергшимися постобработке. Двусторонний тест Студента t .

(C) Репрезентативные изображения мышей Cre и ICE из двухэнергетической рентгеновской абсорбциометрии (DEXA) через 10 месяцев после лечения.

(D) Масса тела мышей Cre и ICE, получавших лечение через 10 месяцев. Двусторонний тест Студента t .

(E) Толщина подкожного жира у мышей Cre и ICE, получавших лечение через 10 месяцев. Двусторонний тест Студента t .

(F и G) Уровни глюкозы в крови у мышей Cre и ICE, получавших лечение через 10 месяцев после еды или натощак. Двусторонний тест Студента t .

(H) Уровни IGF-1 у мышей Cre и ICE, получавших лечение через 10 месяцев. Двусторонний ANOVA-Бонферрони.

(I) Респираторный обменный курс (RER) самок мышей Cre и ICE. Однофакторный дисперсионный анализ с повторными измерениями.

(J) Непрозрачность линз самок мышей Cre и ICE, получавших лечение через 10 месяцев. Двусторонний тест Студента t .

(K) Типичная пигментация хвоста дикого типа, Cre и ICE, а также мышей.Данные представляют собой среднее значение ± стандартная ошибка среднего. н.ш .: p> 0,05; * p <0,05, **** p <0,0001.

Рисунок 3. Мыши ICE — ускоренная фенокопия нормального старения

(A) График фенотипических оценок мышей.

(B) Типичные изображения мышей Cre и ICE.

(C-E) Вес и масса тела мышей Cre и ICE. Однофакторный дисперсионный анализ с повторными измерениями (C). Односторонний ANOVA-Бонферрони (D, слева). Двусторонний ANOVA-Бонферрони (D справа и E).

(F) Респираторный обменный курс (RER) мышей Cre и ICE.Однофакторный дисперсионный анализ с повторными измерениями.

(G) Средняя активность мышей Cre и ICE за 55 дней. Однофакторный дисперсионный анализ с повторными измерениями.

(H) Показатели индекса хрупкости Cre, ICE, мышей дикого типа 3 и 24-месячных мышей. Двусторонний тест Стьюдента t (слева) или двусторонний ANOVA-Бонферрони (справа).

(I) КТ всего скелета и микро-КТ трабекулярных и кортикальных костей мышей Cre и ICE. Оценка кифоза (слева), объем кости / ткани (в центре) и разделение трабекул (справа).Двусторонний тест Студента t .

Данные являются средними ± SEM. н.ш .: p> 0,05; * р <0,05; ** p <0,01; *** p <0,001; **** p <0,0001.

К 10-месячной временной точке после лечения все мыши ICE, но ни один из контрольных мышей, демонстрировали классические черты старости, включая снижение массы тела и жировой массы независимо от приема пищи ( Рисунок 3B, 3C- 3E и S4A-S4H ), более низкий коэффициент респираторного обмена (RER) в течение дня ( Рисунок 3F и S4I ) и уменьшение движения в темноте ( Рисунок 3G ).

Чтобы обеспечить продольную количественную оценку состояния здоровья, мы использовали индекс хрупкости (FI), который объединяет 31 параметр, такой как масса тела, температура, состояние шерсти, сила захвата, подвижность, зрение и слух (Whitehead et al., 2013). Чтобы установить исходный уровень, мы установили показатели FI у мышей WT в возрасте от 3 до 24 месяцев, отметив увеличение в 2,5 раза. Также не было значительной разницы в показателях FI между мышами ICE и контрольной группой через 1 месяц после лечения.Однако к 10- и 12-месячным временным точкам показатели FI мышей ICE были значительно выше, чем у контрольных мышей, ближе к 24-месячным мышам WT (p = 0,0006 и <0,0001, соответственно) ( Рисунок 3H ). наряду с ускоренным кифозом и потерей толщины кортикальной кости и плотности губчатой ​​кости во внутреннем слое (Ferguson et al., 2003; Katzman et al., 2010), оба общих признака старения (, рис. 3I, ).

Мыши ICE демонстрируют связанные с возрастом физиологические изменения кожи и глаз

Одним из отличительных признаков возрастного физического ухудшения у мышей и людей является потеря остроты зрения, вызванная увеличением помутнения хрусталика и дегенерацией функции сетчатки. включая потерю ганглиозных клеток сетчатки (RGC) и их аксонов (Calkins, 2013; Samuel et al., 2011; Wolf et al., 2000). Через десять месяцев после лечения тамоксифеном у мышей ICE было значительно больше помутнения хрусталика по сравнению с контрольной группой Cre (, рис. 4A, 4B и S4J, ). Тела RGC-клеток, которые находятся во внутреннем слое сетчатки, а их аксоны образуют слой нервных волокон, которые собираются в задней части глаза ( Рис. 4C ), особенно уязвимы для возрастного стресса, когда они проходят через головку зрительного нерва. (Даунс, 2015). У мышей ICE было значительно меньше аксонов зрительного нерва в миелинизированной области, что соответствует тому, что обычно наблюдается у 24-месячных мышей дикого типа (, рис. 4D, ).

Рисунок 4. Прогероидные особенности кожи и глаз мышей ICE

(A) График оценки фенотипа.

(B) Типичные изображения и количественная оценка непрозрачности линз. Двусторонний тест Студента t .

(C) Схематическая диаграмма головки зрительного нерва, показывающая расположение тканей, полученных для подсчета аксонов (сплошная линия). V — кровеносные сосуды сетчатки; МТЗ — переходная зона миелинизации; Акс, пучки аксонов.

(D) Репрезентативные микрофотографии миелинизированных аксонов зрительного нерва, окрашенных PPD.Масштабная линейка 10 мкм. Количественная оценка здоровых аксонов, представленная как плотность аксонов (x10 4 ) / мм 2 . Двусторонний тест Студента t .

(E) Окрашивание H&E слоев подкожного жира и субэпидермальной толщины кожи спины старых мышей WT, Cre и ICE. Масштабная линейка 500 мкм. Односторонний ANOVA-тест Бонферрони (в центре) или двусторонний тест Стьюдента t (справа).

(F) KIT (CD117), KRT55 и DAPI окрашивание кожи спины и процент выпуклостей волосяных фолликулов без окрашивания c-kit.Масштабная линейка 50 мкм. Двусторонний тест Студента t .

(G) Окрашивание кожи спины мышей WT, Cre и ICE 5-гидроксиметилцитозином (5hmC). Масштабная линейка 10 мкм. Односторонний ANOVA-тест Бонферрони (в центре) или двусторонний тест Стьюдента t (справа).

Данные являются средними ± SEM. н.ш .: p> 0,05; * р <0,05; ** p <0,01; *** p <0,001; **** p <0,0001.

Кожа млекопитающих также претерпевает явные изменения в процессе старения. Субэпидермальная толщина обычно увеличивается до среднего возраста, а затем быстро снижается вместе с поседением волос из-за потери KIT / CD117-положительных стволовых клеток меланоцитов (Gomes et al., 2013; Мацумура и др., 2016; Nishimura et al., 2005). Эти особенности были ускорены у мышей ICE, включая поседение волос и потерю как субэпидермальной толщины, так и KIT / CD117-положительных меланоцитов (рис. 4E и 4F ).

Мыши ICE демонстрируют связанные с возрастом физиологические изменения в мышцах

Возрастные изменения скелетных мышц хорошо охарактеризованы и включают снижение выносливости при физической нагрузке, мышечной силы, массы, васкуляризации и митохондриальной функции (Das et al. , 2019; Demontis et al., 2013) ( Рисунок 5A ). Через десять месяцев после лечения мыши ICE имели значительно меньшую мышечную массу по сравнению с контрольной группой (, фиг. 5B, ) и демонстрировали снижение беговой выносливости и накопление лактатного эквивалента по сравнению с мышами WT в возрасте 30 месяцев (, фиг. 5C и 5D, ). Сила захвата конечностей у мышей ICE была также ниже, чем у контрольных клеток соответствующего возраста Cre (, рис. 5E, ), больше похожа на мышей в более старшем возрасте. Ключевые признаки старения мышц на клеточном уровне включают снижение уровня АТФ, количества копий митохондриальной ДНК, увеличение площади митохондрий и изменения субарколеммальной и интермиофибриллярной морфологии митохондрий (Demontis et al., 2013; Leduc-Gaudet et al., 2015). Мыши ICE, но не контрольные, показали все эти изменения через 10 месяцев после лечения, напоминая мышей дикого типа в возрасте от 20 до 24 месяцев (, фиг. 5F-5J и S5A-S5D, ).

Рисунок S5. Прогероидные характеристики мышцы ICE мыши, относящиеся к фиг. 5

(A-D) Число митохондрий (A и B) и периметр митохондрий (A, B и D) 10-месячной мышцы Cre и ICE после обработки, определенные с помощью электронной микроскопии. Двусторонний тест Студента t .

(E и F) Количественное определение РНК из повторяющихся элементов ДНК в икроножной мышце и печени у мышей Cre и ICE, получавших лечение через 10 месяцев. Двусторонний тест Студента t .

(G) Эхокардиограмма мышей Cre и ICE, получавших лечение через 10 месяцев. LVPWd, толщина задней стенки левого желудочка в конце диастолы, мм. LVIDd, внутренний диаметр левого желудочка в диастолу; LVPWd, задняя стенка левого желудочка в диастоле; ФВЛЖ, фракция выброса левого желудочка. Двусторонний тест Студента t .

Данные являются средними ± SEM. н.ш .: p> 0,05; * р <0,05; ** p <0,01; *** p <0,001, **** p <0,0001.

Рисунок 5. Прогероидные характеристики мышц мышей ICE

(A) График фенотипических оценок мышей.

(B) Мышечная масса, определенная с помощью МРТ. Двусторонний тест Студента t .

(C-D) Выносливость на беговой дорожке и накопление лактата в крови после тренировки у мышей WT, Cre и ICE. Двусторонний тест Студента t .

(E) Сила захвата, измеренная как максимальная «пиковая сила».Двусторонний тест Студента t .

(F) Уровни АТФ в икроножной мышце. Двусторонний тест Стьюдента t (let) или двусторонний ANOVA-Бонферрони (справа).

(G-J) Число копий митохондриальной ДНК, морфология и площадь. Масштабная шкала 500 нм. Двусторонний тест Студента t .

(K) Окрашивание цитохромоксидазой (ЦОГ) икроножной мышцы. Масштабная линейка, 100 мкм. Двусторонний тест Студента t .

(L и M) Gastrocnemius, иммуноокрашенные ламинином (красный) и CD31 (зеленый), маркерами внеклеточного матрикса и капилляров, соответственно, и их соотношением.Двусторонний тест Студента t .

(N) Количественное определение РНК из повторяющихся элементов ДНК в икроножной мышце. Двусторонний тест Студента t .

Данные являются средними ± SEM. н.ш .: p> 0,05; * р <0,05; ** p <0,01; *** р <0,001.

Другим хорошо известным признаком старения мышц является уменьшение количества цитохромоксидазы, компонента комплекса IV в системе OXPHOS (Wenz et al., 2009). У мышей ICE в возрасте 16 месяцев было в 6 раз меньше ЦОГ-положительных миофибрилл, что соответствует разнице между 6 и 24-месячными мышами WT (, фиг. 5K, ).В соответствии с этим изобилие h4K27ac, маркера активных промоторов и энхансеров, было утрачено из-за генов, участвующих в метаболизме (Yang et al., Рукопись совместно представлена).

Одним из наиболее очевидных изменений в процессе старения у млекопитающих является потеря микрососудов мышц (Das et al., 2019). Отношение капилляров к волокну в скелетных мышцах мышей ICE в возрасте 16 месяцев было примерно вдвое меньше, чем у мышей Cre, и более похоже на отношения, наблюдаемые у мышей в возрасте 24 месяцев (, рис. 5L и 5M, ). Утрата молчания повторяющихся элементов и ретротранспозонов также является консервативным признаком старения и потенциальным фактором воспаления (De Cecco et al., 2019; Oberdoerffer et al., 2008), и это также было замечено в скелетных мышцах мышей ICE по сравнению с контрольными Cre ( Рисунок 5N, S5E и S5F ). В среднем у мышей ICE была более тонкая задняя стенка левого желудочка (LV), чем у контрольной группы Cre, что предполагало возможную дилатационную кардиомиопатию, без разницы во внутреннем диаметре LV или фракции выброса ( Рисунок S5G ).

Мыши ICE испытывают изменения в мозге, которые обычно наблюдаются у гораздо более старых мышей

Одним из основных признаков старения млекопитающих является снижение функции ЦНС, проявляющееся в нарушениях координации движений и познания (, рис. 6A). ) (Johnson et al., 2018; Унгвари и др., 2017). В темноте амбулаторная активность была на 50% ниже у мышей ICE по сравнению с контрольной группой Cre (, рисунок 6B, ), и координация походки, основанная на времени качания и стойки, также была нарушена (, рисунок S6A-S6C ). Гиппокамп имеет решающее значение для пространственной консолидации и консолидации памяти, функция которой предсказуемо ухудшается с возрастом (Gallagher et al., 2010; Miller and O’Callaghan, 2005; Park and Reuter-Lorenz, 2009). В парадигме кондиционирования страха кратковременная память измеряется путем помещения их в определенный контекст и воздействия на них электрического шока в день 1, который они должны вспомнить на день 2 и показать реакцию замирания.Поскольку эти параметры не были хорошо охарактеризованы для пожилых C57BL / 6J, мы установили исходный уровень. Реакция немедленного замораживания была аналогичной у молодых и старых мышей (6-, 24- и 30-месячных) в день 1, но на второй день замерзли 75% молодых мышей по сравнению с <40% старых мышей, что указывает на у старых мышей была пониженная способность вспоминать контекст накануне ( Рисунок 6C-E) . Очень похожая разница была замечена при сравнении мышей Cre и ICE в возрасте 16 месяцев, при этом> 40% контрольных Cre реагировали на контекст на второй день, по сравнению только с примерно 24% мышей ICE ( Рисунок 6D- E ).

Рисунок S6. Нарушение координации походки у мышей ICE, относящееся к фиг. 6

(A-C) Анализ походки мышей Cre и ICE. Двусторонний тест Студента t . Данные представляют собой среднее значение ± стандартная ошибка среднего. * р <0,05.

Рисунок 6. Мозг мышей ICE, похоже, претерпевает ускоренное старение

(A) График фенотипических оценок мышей.

(B) Амбулаторная деятельность в светлое и темное время суток. Двусторонний ANOVA-Бонферрони.

(C и E) Немедленное и контекстное замирание в тестах на условный страх.Односторонний дисперсионный анализ-анализ Бонферрони (D, слева и E, слева) или двусторонний тест Стьюдента t (D, справа и E, справа).

(F) Репрезентативные изображения тестов лабиринта Барнса и среднее количество толчков в каждой лунке. Двусторонний ANOVA-Бонферрони.

(G и H) Иммунофлуоресценция области CA3 гиппокампа, иммуноокрашенная на маркеры воспаления GFAP и Iba1. Масштабная линейка, 100 мкм. Двусторонний тест Студента t .

Данные являются средними ± SEM. н.ш .: p> 0,05; * р <0,05; ** p <0.01; *** p <0,001; **** p <0,0001.

Еще одним показателем функции гиппокампа и долговременной памяти является тест лабиринта Барнса. В течение пяти дней мыши учатся определять местоположение тайника, а затем, через 7 дней, мышей повторно проверяют на способность вспоминать местонахождение тайника. Отзыв мышей ICE был примерно вдвое меньше, чем у контрольных мышей соответствующего возраста, аналогично отзыву мышей WT в возрасте 24 месяцев (, фиг. 6F, ).

В центральной нервной системе астроциты и микроглия являются важнейшими медиаторами врожденного иммунного ответа.По мере старения млекопитающих врожденная иммунная система становится гиперактивированной, и количество активированных микроглии и астроцитов, которые можно обнаружить с помощью окрашивания на Iba1 и GFAP, увеличивается (Baruch et al., 2014; Norden and Godbout, 2013). В когорте WT в гиппокампе 24-месячных мышей было больше GFAP- и Iba1-положительных клеток по сравнению с 6-месячными мышами, что согласуется с предыдущими сообщениями (Baruch et al. , 2014). Параллельно нормальному старению мыши ICE в возрасте 16 месяцев имели значительное количество GFAP- и Iba1-положительных клеток, 1.В 6 и 3,5 раза больше, чем в контрольных образцах Cre ( Рисунок 6G и 6H ). Вместе эти данные указывают на то, что у мышей ICE наблюдается ускоренное воспаление мозга и потеря памяти, что напоминает нормальное старение.

Мыши ICE испытывают связанные с возрастом транскрипционные изменения и ускорение эпигенетических часов

Чтобы обеспечить более количественную оценку биологического возраста, мы сравнили паттерны экспрессии генов и паттерны метилирования ДНК (DNAme) ICE и контролей. В скелетных мышцах гены, регуляция которых была значительно нарушена у мышей ICE, положительно коррелировали с изменениями у 24-месячных мышей дикого типа (, фиг. 7B-D, S7A, S7B и таблица S2 ).Известные примеры включают медиатор опосредованного p53 клеточного старения Cdkn1a (циклинзависимый ингибитор киназы 1A или p21) (Beggs et al. , 2004; Choudhury et al., 2007; Welle et al., 2004), Myl4 ( Легкая цепь миозина 4), которая кодирует эмбриональную форму миозина, которая активируется в мышцах старых мышей (Lin et al., 2018), Nlrc5 (домен CARD семейства NLR, содержащий 5), который ингибирует активацию NF-κB и является одним из из наиболее существенно гипометилированных генов у долгожителей (Zeng et al., 2018) и Mrpl55 (митохондриальный рибосомный белок L55), который кодирует митохондриальный рибосомный ген 39S, статус метилирования которого связан с продолжительностью жизни (Weidner et al., 2014; Zhang et al., 2017).

Рисунок S7. Мыши ICE имитируют транскриптомные изменения старых мышей дикого типа, относящиеся к фиг. 7

(A) График разброса значительно измененных генов (p <0,01) у мышей ICE, получавших лечение через 10 месяцев, или мышей дикого типа в возрасте 24 месяцев.

(B) Кратковременное изменение измененных генов (padj <0.05, 12мес. против 24 мес.) у мышей ICE, получавших лечение через 10 месяцев.

Рисунок 7. Мыши ICE испытывают ускорение эпигенетических часов

(A) График фенотипических оценок мышей.

(B) График разброса генов значительно изменился (p <0,01) у 10-месячных мышей ICE, получавших лечение, и 24-месячных мышей дикого типа.

(C) Кратное изменение измененных генов (padj <0,05, Cre по сравнению с мышами ICE) у 24-месячных мышей дикого типа.

(D) Тепловые карты 200 наиболее сильно измененных генов в скелетных мышцах Cre и ICE мышей.

(E-H) Тренировка мышц и крови (E и F) и наборы для тестирования (G и H) сайтов CpG часов у мышей WT C57BL / 6J.

(I) График Circos геномных местоположений сайтов разрезания I- Ppo I (зеленый), сайтов синхронизации GpG на островках CpG (красный) и всех сайтов синхронизации (синий).

(J) Эпигенетический возраст гастрокнемии мышей Cre и ICE через 1, 10 и 14 месяцев после лечения. Линейный регрессионный анализ и корреляция Спирмена.

(K) Эпигенетический возраст мышц и крови мышей Cre и ICE через 10 месяцев после лечения (Δ age = эпигенетический возраст — хронологический возраст. ). Двусторонний тест Студента t .

(J) Модель того, как разрывы ДНК и возникающий в результате эпигенетический шум способствуют старению. Данные представляют собой среднее значение ± стандартная ошибка среднего. * р <0,05; ** p <0,01; **** p <0,0001.

Часы

метилирования ДНК (DNAme) являются надежным индикатором биологического возраста у млекопитающих (Hannum et al., 2013; Horvath, 2013; Petkovich et al., 2017; Weidner et al., 2014). Чтобы оценить относительный возраст ДНК-мускулов у мышей ICE, мы разработали часы ДНК-мускулатуры для скелетных мышц и крови, оценивая мышей дикого типа в 8-10 разном возрасте ( Рисунок 7A, ).Секвенирование бисульфита с пониженной репрезентативностью (RRBS) на 79 скелетных мышцах и 118 образцах цельной крови выявило 915 ассоциированных с возрастом локусов CpG для панели крови и 2048 локусов CpG для панели с множеством тканей. Целевые библиотеки бисульфитного секвенирования с использованием упрощенного метода реакции амплификации на всей панели (SWARM) затем использовали для оценки изменений метилирования ДНК на> 2000 сайтах CpG, секвенированных с охватом> 2500x. Мы использовали 61 WT мышечных и 29 WT образцов крови от самцов и самок мышей C57BL / 6 в возрасте от 2 до 30 месяцев для определения обучающей выборки ( рис. 7E-F ) и отобрали 2048 мульти-тканевых CpG часов с помощью регрессионной модели ElasticNet с CpG. сайты с не менее 300 чтений во всех выборках.Эпигенетический возраст для образцов мышц и крови был рассчитан как: эпигенетический возраст = обратный F (b 0 + b 1 CpG 1 + ⋯ + b n CpG n ) , где b — коэффициенты, полученные из обученной модели, где ; b 0 — перехват, а CpG — значения метилирования локусов.

В наборе обучающих данных эпигенетический возраст, полученный из взвешенной суммы уровней метилирования ДНК модулированных по возрасту сайтов CpG, сильно коррелировал с хронологическим возрастом отдельных образцов, с R 2 = 0.995 и 0,992 для мышц и кровяных часов, соответственно ( Рисунок 7E-F и Таблица S3 ). Для проверки для набора данных тестирования использовались 18 образцов мышц и 90 образцов крови в возрасте от 2 до 30 месяцев (, рис. 7G-H, ). Часы показали хорошие результаты в наборах данных проверки с R 2 = 0,915 и 0,944 для мышечных и кровяных часов соответственно, что указывает на то, что оба смогли точно оценить возраст с использованием двух полностью независимых наборов данных. По всему геному 40% сайтов синхронизации ДНКме находились в островках CpG, 30% — в интронах, 20% — в кодирующих последовательностях и менее 5% — в энхансерах или 3 ’UTR.Не было перекрытия между сайтами DNAme и известными последовательностями узнавания I- Ppo I (, фиг. 7I, ).

Используя эти две мышиные часы, скорость эпигенетического старения была оценена примерно на 50% быстрее у мышей ICE, чем у контрольных Cre (p <0,0001) ( Рисунок 7J) . Вычитая хронологический возраст из эпигенетического возраста, мы определили изменение возраста (Δ age). Разница между хронологическим и эпигенетическим возрастом (дельта-возраст) также указала на то, что мыши ICE были старше контрольных Cre как по мышцам, так и по кровяным часам ( Рисунок 7K, ).

ОБСУЖДЕНИЕ

Во время эмбриогенеза эукариотические клетки устанавливают свою идентичность, устанавливая определенный паттерн эпигенетической информации (Waddington, 1957). Почему и как млекопитающие со временем теряют эпигенетическую информацию, и является ли этот процесс основной причиной старения, в настоящее время являются предметом размышлений. Вместе результаты этого исследования в сочетании с результатами в сопроводительной рукописи (Yang et al.) Показывают, что индукция умеренного ответа на повреждение ДНК ускоряет эпигенетический дрейф, который вызывает фенотипы и молекулярные изменения, напоминающие нормальное старение ( Рис. 7L ).Данные убедительно доказывают, что процесс восстановления DSB, даже если он не приводит к мутации, изменяет эпигеном и ускоряет старение у мышей на физиологическом, гистологическом и молекулярном уровнях, включая ускорение эпигенетических часов.

Насколько нам известно, эти исследования определяют первый молекулярный драйвер эпигенетических изменений во время старения и первый набор убедительных доказательств того, что они управляют процессом старения. Наша сопроводительная статья (Yang et al.) Добавляет дополнительный вес нашему выводу, демонстрируя, что немутагенные разрывы ДНК изменяют структуру эпигенома предсказуемым образом, который очень похож на нормальное старение, включая модификации гистонов, компартментализацию ДНК, сглаживание эпигенетических пейзаж и потеря клеточной идентичности.Предыдущие данные о дрожжах и новые данные о млекопитающих подтверждают гипотезу о том, что эпигенетический дрейф, вызванный репарацией DSB, является консервативной причиной старения у всех эукариот.

Традиционно процесс активации контрольной точки повреждения ДНК и репарации ДНК изучается с использованием мутагенов или доз облучения, которые вызывают повреждение ДНК, значительно превышающее фоновый уровень. Система ICE позволяет нам создавать DSB на более естественных уровнях, всего в несколько раз выше фона, что позволяет избежать явного сигнального ответа на повреждение ДНК, остановки клеточного цикла, анеуплоидии, мутаций или клеточного старения (Yang et al. , совместно поданная рукопись). Первоначально у обработанных мышей ICE не наблюдали глубоких изменений на физиологическом или молекулярном уровнях. Действительно, эпигенетические часы изначально не продвигались. Однако в течение следующих 10 месяцев каждая ткань, которую мы исследовали, испортилась, и появились признаки старения. Это наблюдение предполагает, что молекулярные изменения, происходящие во время или вскоре после лечения, запускают продвижение эпигенетических часов много месяцев спустя. Мы еще не знаем, что это за триггеры, но предполагаем, что это могут быть изменения в ДНК, хроматине или транскрипционных сетях, которые инициируют каскад вредных событий с прямой связью.Дальнейшая работа будет направлена ​​на выявление этих каскадов.

У людей имеется множество доказательств, связывающих повреждение ДНК со старением, включая химиотерапию рака, облучение, курение и прогероидные заболевания, такие как синдром Вернера и Кокейна (Hofstatter et al., 2018; Horvath and Levine, 2015; Maccormick. , 2006; Nance, Berry, 1992; Salk et al., 1985). Точно так же у модельных организмов дефицит репарации ДНК, такой как мыши с мутантами Ercc1, BubR1, Ku70 и Xpd, также, по-видимому, ускоряет процессы старения (Carrero et al., 2016; White and Vijg, 2016). Но накопление мутаций как основная причина старения было трудно согласовать с другими выводами о том, что ядерные мутации у старых людей не только реже, чем можно было бы ожидать, они могут происходить с высокой частотой, не вызывая признаков старения (Dolle et al., 2006). ; Dolle et al., 1997; Narayanan et al., 1997).

Исследования на простых организмах, таких как дрожжи и мухи, показали, что изменения эпигенома являются причиной старения (Imai and Kitano, 1998; Jiang et al., 2013; Миллс и др., 1999; Oberdoerffer et al., 2008). Вызывая повреждение ДНК, не вызывая мутаций в клетках и мышах, мы предоставляем веские доказательства того, что именно реакция клетки на разрывы ДНК, а не фактические мутации, управляет часами старения. Эта идея особенно привлекательна, потому что она объясняет, почему старение происходит через предсказуемую серию молекулярных и физиологических изменений, несмотря на то, что повреждение ДНК может произойти в любом месте генома.

Эти данные также помогают объяснить, почему эффективность репарации DSB коррелирует с продолжительностью жизни у различных видов, но не другими типами репарации ДНК, такими как NER и BER (Brown and Stuart, 2007; Tian et al., 2019). В нашей модели DSB представляют собой особый тип повреждений, которые сильно вызывают эпигенетические изменения. Поскольку дефекты связанной с транскрипцией репарации ДНК (TCR) у мышей с мутантным ERCC1 также имитируют старение (Niedernhofer et al., 2006), будет интересно определить, индуцирует ли TCR также ответ RCM, эпигеномные изменения и ускорение часов ДНК-мезона. Учитывая, что ERCC1 играет незаменимую роль в репарации DSB, содержащих вторичные структуры ДНК, включая AT-богатые последовательности ДНК в хрупких сайтах и ​​G-квадруплексы (Li et al., 2019), возможно, фундаментальный механизм, лежащий в основе мутантного фенотипа ICE и ERCC1, одинаков.

Известно, что у лиц, получавших препараты, генерирующие DSB, такие как химиотерапия, рентгеновское излучение и гамма-излучение, ускоряется старение (Garrett-Bakelman et al. , 2019; Maccormick, 2006; Richardson, 2009). В этом исследовании низкие уровни DSB оказались неожиданно эффективными, даже спустя несколько месяцев, что вызвало опасения, что очень низкие дозы радиации и даже ферменты редактирования ДНК могут иметь пагубные долгосрочные эффекты на эпигеном и функцию тканей.

Негативное влияние DSB на эпигеном поднимает вопрос, почему RCM вообще возникла. Мы предполагаем, что это древняя система, которая переводит клетки в состояние повышенной готовности во время восстановления DSB. На молекулярном уровне DSB индуцируют перемещение факторов транскрипции и белков, модифицирующих хроматин, в сайт DSB, тем самым вызывая скоординированный ответ на повреждение ДНК на уровне транскрипции во время репарации. Факторы, которые, как известно, перемещаются, включают гистоновые деацетилазы SIRT1, SIRT6, HDAC1 и поли-АДФ-рибозную полимеразу, PARP1 (Dobbin et al., 2013; Мао и др., 2011; Oberdoerffer et al., 2008). После репарации большая часть исходной структуры хроматина восстанавливается, но повторный запуск ответа нарушает паттерны экспрессии молодых генов и может подавлять молчание ретротранспозонов, которые сдерживаются SIRT1 и SIRT6 (De Cecco et al. , 2019; Oberdoerffer et al. al., 2008; Simon et al., 2019), аналогично эрозии ландшафта Уоддингтона или накоплению эпигенетического шума. Почему эпигенетические часы опережают DSB, остается загадкой, но одна из возможностей заключается в том, что DSB вызывают перемещение десяти одиннадцати ферментов транслокации (Tets) или ДНК-метилтрансфераз (DNMT) к разрывам ДНК, что приводит к определенным изменениям в паттернах метилирования ДНК с течением времени ( Филд и др., 2018).

Мы не можем исключить, что некоторые эффекты, которые мы наблюдаем у мышей ICE, связаны с разрезанием локуса рДНК. Действительно, нестабильность рДНК является известной причиной старения дрожжей, а размер ядрышка определяет продолжительность жизни (Sinclair et al., 1997; Tiku et al., 2017). Учитывая, что мы не видели доказательств мутаций рДНК, изменений уровней рРНК или трансляции белка, а также в свете наблюдения, что фермент I- Sce I, который разрезает на разных сайтах генома, генерирует аналогичный паттерн экспрессии гена (Yang et al. al., совместно представленная рукопись), нестабильность рДНК не может объяснить фенотип ICE. Дальнейшая работа будет включать тестирование систем на основе CRISPR, которые не вызывают мутации или остановки клеточного цикла (Chen et al., 2017; Kleinstiver et al., 2016) или тех, которые направляют сигнальные белки повреждения ДНК в локус без активации сигнала DSB. (Сотоглоу, Мистели, 2008).

Двойственность снижения молчания и увеличения репарации ДНК была впервые обнаружена у почкующихся дрожжей, у которых дерепрессия генов молчащего типа спаривания увеличивает эффективность репарации ДНК (Lee et al., 1999), но конститутивная дерепрессия вызывает потерю клеточной идентичности и стерильности, что является признаком старения дрожжей (Smeal et al., 1996). Это наглядный пример антагонистической плейотропии, при которой адаптивный процесс, который способствует выживанию молодых особей, нарушает гомеостаз в пожилом возрасте, когда влияние естественного отбора падает почти до нуля.

Помимо облегчения нового понимания эпигенетических изменений во время старения, система ICE может преодолеть множество других исследовательских проблем. Короткоживущие виды, такие как грызуны, оказались плохой моделью многих возрастных заболеваний человека. Однако мыши ICE могут решить эту проблему, увеличив эпигенетический возраст мышей. Действительно, некоторые из фенотипов мышей ICE, такие как дегенерация сетчатки, потеря кровоснабжения и потеря памяти, очень напоминают старение у людей. А ускоряя старение в определенных тканях, можно будет проверить, насколько отдельные системы органов способствуют старению. Внедрение системы ICE в ИПСК человека должно стать возможным для создания культур тканей человека и органоидов, которые воспроизводят болезни старения человека лучше, чем те, которые доступны в настоящее время.

Поскольку DSB ускоряют эпигенетические часы и процесс старения, возможно, эти два процесса тесно связаны. Еще неизвестно, возможно ли повернуть часы вспять, восстановить потерянную эпигенетическую информацию и восстановить функцию тканей, но недавние данные показывают, что это возможно (Lu et al., 2019; Ocampo et al. , 2016) . Если это так, возможно, нам удастся понять, почему мы стареем и как это исправить.

ВЗНОС АВТОРА

М.Х., Ж.-Х.Й. и D.A.S. спроектировал, выполнил и проанализировал большинство экспериментов. M.S.B., J.A.A., P.T.G. и D.L.V. помог написать рукопись. J.A.A. и M.S.B. провели электронную микроскопию. J.M.R., J.A.A., G.C. и M.A.R. провели анализ мозга и поведенческие тесты. Y.C.C., W.G. и X.Y. вычислен эпигенетический возраст. P.T.G., D.L.V. и E.L.S. проанализировали данные RNA-seq и WGS. S.J.M. и A.E.K. оценили слабость мышей. Y.M., E.K.N., M.S.B. и Г.Ф.М. выполнена кожная ИГХ. L.Z. и Р. способствовал распространению метафазы.N.S.W., M.G.-K., T.C.J. и Б.Р.К. оценивали фенотипы глаз. H.W., J.G.S. и C.E.S. выполнены эхокардиограммы. J.A.K. и J.M.S. измеренная активация повторяющихся последовательностей. A.D., S.T., N.G., A.-M.B., S.J.B. и L..S. провели анализ фенотипа мышей. K.T., C.M.P. и A.J.W. предоставил консультации и помощь с экспериментами. P.O. и D.A.S. разработали конструкцию I- Ppo I и создали мышь I- Ppo I. L.A.R. инициировал исследование на мышах ICE и предоставлял консультации и помощь во всем.D.A.S. разработал и руководил исследованием. J.-H.Y., M.H. и D.A.S. написал рукопись.

ДЕКЛАРАЦИЯ ИНТЕРЕСОВ

DAS является консультантом, изобретателем патентов, лицензированных для, а в некоторых случаях членом совета директоров и инвестором MetroBiotech, Cohbar, InsideTracker, Jupiter Orphan Therapeutics, Vium, Zymo, EdenRoc Sciences и дочерних компаний, Life Biosciences и дочерние компании, Segterra и Galilei Biosciences, Immetas и Iduna. Он также является автором патентных заявок, выданных Bayer Crops, Merck KGaA и Elysium Health.Подробнее см. Https://genetics.med.harvard.edu/sinclair/. Y.C.C., W.G. и X.Y. являются сотрудниками Zymo Research Corporation. A.J.W. является консультантом Frequency Therapeutics и соучредителем Elevian. Л.С. является сотрудником Vium. Все остальные авторы заявляют об отсутствии конкурирующих интересов.

ПОДРОБНОЕ ОПИСАНИЕ МЕТОДА

Мыши и лечение

I- Ppo I STOP «нокаутированные» мышиные ES-клетки были получены следующим образом. Вкратце, домен ядерной транслокации рецептора эстрогена (ER T2 ), помеченный HA на N-конце и I- Ppo I, был вставлен в плазмиду STOP-eGFP-ROSA26TV (аддген, плазмида № 11739) вместе с последующими IRES и EGFP. последовательность.HA-ER T2 -I- Ppo I Кассета STOP была интегрирована в локусы Rosa26, и нацеленные ES-клетки C57BL6 инъецировались в бластоцисты C57BL / 6 albino (cBRD / cBRD). После обратного скрещивания химерных мышей I- Ppo I STOP / + с мышами C57BL / 6 получали мышей ICE путем скрещивания мышей I- Ppo I STOP / + с мышами Cre ERT2 / + , несущих единственный ER T2 , слитый с Cre-рекомбиназой, индуцируемый всем телом (Ruzankina et al., 2007). 4-6-месячных мышей Cre и ICE кормили модифицированной диетой для грызунов, очищенной AIN-93G, с 360 мг / кг цитрата тамоксифена в течение 3 недель для проведения индукции I- Ppo I. ER T2 , содержащий три мутации, избирательно связывается с 4-гидрокситамоксифеном (4-OHT), но не с эстрадиолом. Белок Cre-ER T2 перемещается в ядро ​​обработкой тамоксифеном с последующим удалением кассеты STOP, расположенной выше I- Ppo I. В присутствии тамоксифена Cre-ER T2 и HA-ER T2 -I- Ppo I локализуется в ядре и индуцирует двухцепочечные разрывы ДНК.В возрасте мышей дикого типа получали из колоний старых грызунов NIA и акклиматизировались, по крайней мере, в течение месяца перед экспериментом. Мышей кормили диетой LabDiet 5053, и весь уход за животными соответствовал рекомендациям комитетов по уходу и использованию животных (IACUC) в Гарвардской медицинской школе.

Культура клеток

Клетки культивировали, как описано в Yang et al. (совместно представленная рукопись)

Вестерн-блоттинг

Образцы клеток и тканей лизировали в буфере RIPA (50 мМ Трис-HCl, pH 7.4, 150 мМ NaCl, 0,25% дезоксихолевой кислоты, 1% NP-40, 1 мМ ЭДТА), содержащий коктейль ингибиторов протеиназ (Sigma-Aldrich). Равное количество лизата инкубировали с буфером для образцов (0,05% бромфенолового синего, 2% додецилсульфата натрия, 50 мМ трис-Cl, pH 6,8, 5% β-меркаптоэтанол) при 95 ° C в течение 5 минут, затем разделяли на SDS-PAGE. градиентный гель, переносимый на мембрану с использованием буфера для переноса (25 мМ Трис-HCl pH 8,3, 190 мМ глицин 20% метанол), блокированный TBSTM (Трис-буферный солевой раствор, 0,1% Твин 20, с 5% обезжиренным молоком), зондирование первичные и вторичные антитела, разработанные с использованием реагента для обнаружения вестерн-блоттинга ECL (Sigma-Aldrich).

Анализ комет

Анализ комет выполняли с использованием набора OxiSelect Comet Assay Kit (Cell Biolabs). Вкратце, 10 4 клеток ресуспендировали в 100 мкл жидкой агарозы и сразу же добавляли 75 мкл на предметные стекла с кометами, затем инкубировали при 4 ° C в течение 15 минут для затвердевания агарозы. Слайды погружали в предварительно охлажденный буфер для лизиса при 4 ° C на 45 минут, переносили в щелочной раствор (300 мМ NaOH, pH> 13, 1 мМ EDTA) и хранили при 4 ° C в течение 60 минут в темноте. Электрофорез проводили в холодном щелочном растворе, затем предметные стекла промывали водой и 70% этанолом. После сушки агарозы на воздухе ДНК окрашивали Vista Green, и моменты оливкового хвоста кометы (% ДНК хвоста × длина момента хвоста) измеряли с использованием программного обеспечения CASPLab (http://casplab.com/).

Саузерн-блоттинг

Образцы геномной ДНК получали с использованием набора EZNATissue DNA Kit (Omega Bio-tek). ДНК (3 мкг) прогоняли в 0,8% агарозном геле, ДНК депуринировали в 0,25 н. HCl, денатурировали в 0,4 н. NaOH и промывали 20X SSC. ДНК переносили на нейлоновую мембрану в 0,4 N NaOH с помощью TurboBlotter (Whatman), промывали 2X SSC, сшивали УФ, затем инкубировали в растворе для предварительной гибридизации (6X SSC, 5X раствор Денхардта, 1X SSD, 0.0625 M Tris-HCl pH7,5, 75 мк / мл ДНК спермы лосося) при 65 ° C в течение 3 часов с вращением. ДНК-зонды были созданы с использованием целевой ПЦР с dCTP [α-32P]. Радиоактивные ДНК-зонды добавляли к свежему раствору для предварительной гибридизации и инкубировали с мембраной в течение ночи при вращении. Мембрану промывали 2X SSC, 2X SSC, содержащим 1% SDS и 0,1X SSC, и экспонировали рентгеновской пленкой при -80 ° C.

Surveyor assay

I- Целевые области Ppo I амплифицировали из геномной ДНК, выделенной из клеток Cre или ICE с помощью ПЦР с использованием наборов фланкирующих праймеров.Гетеро- или гомодуплексы гибридизовали в термоциклере и гибридизованную ДНК (200 нг) обрабатывали нуклеазой SURVEYOR (Transgenomic) при 42 ° C в течение 60 мин. Нуклеазные реакции были остановлены, и расщепление было проанализировано с помощью электрофореза в агарозном геле или биоанализатора (Agilent).

Метаболическое мечение MEF.

MEF дважды промывали средой для импульсной маркировки (Met-Cys-free DMEM, содержащая 10% диализованной сыворотки) и инкубировали в среде для импульсной маркировки в течение 1 ч для истощения внутриклеточного метионина.Среду для импульсного мечения с 0,2 мКи / мл метионина [35S] добавляли к клеткам и инкубировали в течение 1 часа. Клетки лизировали, и включение 35 S-метионина определяли осаждением TCA и сцинтилляционным счетом.

Метафазное распространение и теломеры FISH

Клетки обрабатывали колцемидом (10 мкг / мл, Gibco) в течение 4 часов. Трипсинизированные клетки промывали PBS и смешивали в предварительно нагретых 4 мл 0,075 М KCl путем встряхивания. После 15 мин инкубации добавляли фиксирующий раствор (метанол: уксусная кислота = 3: 1).Клетки помещали в увлажненные паром предметные стекла и сушили на горячей плите. Клетки фиксировали в 4% формальдегиде в течение 2 минут, затем переваривали пепсином в течение 10 минут. Был проведен еще один раунд фиксации, и клетки были обезвожены в 70%, 90%, 100% EtOH в течение 5 минут каждый. Приготовили зонд PNA FISH (PNA BIO) с 0,5 мкг / мл теломер и инкубировали при 80 ° C в течение 3 мин. Зонд добавляли к предметным стеклам и инкубировали при комнатной температуре в течение 2 часов. Слайды промывали, обезвоживали и сушили, а ядра окрашивали антифадной монтажной средой, содержащей DAPI (Vector Laboratories).

Количественная оценка DSB

Двухцепочечных разрывов ДНК (DSB), генерируемых I- Ppo I, были обнаружены, как описано ранее (Chailleux et al., 2014). Вкратце, ткань гомогенизировали в феноле, а геномную ДНК очищали хлороформом, этанолом и РНКазой. Геномная ДНК, несущая DSB, специфичные для I- Ppo I, была подвергнута очистке с помощью лигирования с использованием конъюгированных с биотином адаптерных нуклеотидов с выступами 5’-AATT-3 ’, которые связываются с сайтом DSB, созданным I- Ppo I.Последовательности адаптеров были следующими: dRbiot-BglII-IPpoI F 5 ’-CCCTATAGTGAGTCGTATTAGATCTGCGTTAA-3’, dRbiot-BglII-IPpoI R 5 ’-CGCAGATCTTAATACGACTCACTATAGGG-3’. Биотинилированный фрагмент расщепляли с использованием Eco RI в течение 3 ч при 37 ° C с последующей очисткой магнитными шариками стрептавидина (Dynabeads M-280 Streptavidin, Invitrogen) в связывающем буфере (20 мМ Трис-HCl pH 8,0, 0,1% SDS, 1 % Triton X-100, 2 мМ EDTA, 150 мМ NaCl). Через 4 ч при 4 ° C шарики пять раз промывали промывочным буфером (50 мМ трис-HCl, pH 8.0, 0,1% SDS, 150 мМ NaCl) и один раз с буфером ТЕ. Разрезанную ДНК элюировали перевариванием адаптера Bgl II при 37 ° C в течение ночи. ДНК очищали с использованием гликогена, ацетата натрия и этанола. Праймерами ДНК были: 5 + 11 F 5‘-ACTTAGAACTGGCGCTGAC-3 ’, 5 + 11 R 5’-CTGGCCTGGAACTCAGAAAT-3 ’, 28S F CCCACTGTCCCTACCTACTATC, 28S R AGCTCAACAGGGTCTTCTTTC.

Количественная оценка синтеза белка

Синтез белка был количественно определен, как опубликовано (Garlick et al., 1980; Hofmann et al., 2015). L- 3 H-фенилаланин (1 мКи / мл) объединяли с немеченым фенилаланином (135 мМ) для получения 100 мКи / мл.После доведения pH раствора до 7,1 с помощью NaOH раствор для маркировки вводили через боковую хвостовую вену из расчета 1 мл / 100 г веса тела под анестезией кетамином (75 мг / кг) и ксилазином (10 мг / кг).

Косвенная калориметрия

Потребление пищи, амбулаторная активность, потребление кислорода (VO 2 ), выработка углекислого газа (VCO 2 ) и коэффициент дыхательного обмена (RER) измерялись с помощью Columbus Instruments CLAMS. Перед сбором данных мышей помещали в метаболические клетки на 3 дня, а состав тела определяли с помощью ЭхоМРТ 3-в-1.

MMQPCR

Монохромная мультиплексная количественная ПЦР была выполнена, как описано ранее (Cawthon, 2009). Вкратце, реакция ПЦР, содержащая 20 нг геномной ДНК, была приготовлена ​​с использованием системы SYBR Green (Applied Biosystems). Программа ПЦР была настроена как Шаг 1: 95 ° C; 15 мин. Шаг 2; 2 цикла 94 ° C в течение 15 секунд и 49 ° C в течение 15 секунд, Шаг 3:32 цикла 94 ° C в течение 15 секунд, 62 ° C в течение 15 секунд, 74 ° C в течение 15 секунд с получением сигнала для теломер или 28S амплификация, 84 ° C в течение 10 секунд, 88 ° C в течение 15 секунд с получением сигнала для амплификации Hbbt1.Праймеры перечислены в таблице 1.

Оценка индекса хрупкости

Индекс хрупкости (FI) оценивали, как описано ранее (Whitehead et al., 2013). Вкратце, у каждой мыши оценивали 31 дефицит, связанный со здоровьем. Мышь взвешивали и трижды измеряли температуру поверхности тела с помощью инфракрасного термометра (La Crosse Technology). Массу тела и температуру оценивали на основе их отклонения от средней массы и температуры молодых мышей (Whitehead et al 2014). Двадцать девять других объектов для кожных покровов, физической / скелетно-мышечной, оскулярной / носовой, пищеварительной / мочеполовой и дыхательной систем были оценены как 0, 0.5 и 1 в зависимости от степени дефицита. Общий балл по элементам был разделен на количество элементов, измеренных, чтобы получить оценку индекса хрупкости от 0 до 1.

Оценка непрозрачности линзы

Оценка непрозрачности линзы была описана ранее (Wolf et al., 2008). Мышей держали без анестезии и оценивали в темной комнате с помощью ручной щелевой лампы SL-14 Kowa (Kowa, Токио, Япония).

PET-CT

Мышей анестезировали 2% газообразным изофлураном в кислороде и вводили ~ 200 мкКи фтородезоксиглюкозы (FDG), меченной F-18, через инъекцию в хвостовую вену.Через 45 минут мышей визуализировали на сканере изображений мелких животных Siemens Inveon для получения изображений позитронно-эмиссионной томографии (ПЭТ) и компьютерной томографии (КТ) под изофлураном. КТ-изображение было выполнено для 360 проекций с помощью рентгеновской трубки на 80 кВп и 500 мкА и реконструировано с использованием модифицированного алгоритма реконструкции конусного луча Фельдкампа (COBRA Exxim Inc. , Плезантон, Калифорния) с временем экспозиции / проекции 425 мс, в течение которого Isovue-360 ( Bracco Diagnostic Inc, Monroe Township, NJ) закачивали мышам через хвостовую вену со скоростью 20 мкл в минуту.Сканы ПЭТ были реконструированы с максимизацией упорядоченного подмножества ожидания с максимальным алгоритмом апостериорной реконструкции с 2 итерациями OSEM и 18 итерациями MAP.

Магнитно-резонансная томография

Мышей анестезировали 2% газообразным изофлураном в кислороде и помещали в магнитно-резонансный томограф Bruker Pharamscan 4,7 Тл. Редкий T1 (TE: 13,4 мс, TR: 900 мс, редкий фактор: 4, матрица: 256 × 256 × 24, размер вокселя: 0,215 × 0,156 × 1 мм) и редкий T2 (TE: 18,26 мс, TR: 2000 мс , Редкость: 8, Матрица: 256 × 256 × 24, Размер вокселя: 0.215 × 0,156 × 1 мм) сканирование нижней части грудной полости, живота и нижних конечностей.

Микро КТ сканирование

Бедренные кости были изолированы и помещены в 70% этанол. Микро-КТ выполнялась с использованием SCANCO Medical μ-CT35 на базовом предприятии Гарвардской школы стоматологической медицины (Иделевич и др. , 2018).

Количественное определение аксонов зрительного нерва

Для количественного определения аксонов зрительные нервы препарировали и фиксировали в реактиве Карновского (50% в фосфатном буфере) в течение ночи.Полутонкие поперечные срезы нерва были сделаны на расстоянии 1,0 мм кзади от глазного яблока и окрашены 1% п-фенилендиамином (PPD) для оценки с помощью световой микроскопии. Было сделано от шести до восьми неперекрывающихся микрофотографий при 60-кратном увеличении, охватывающих всю площадь поперечного сечения зрительного нерва. Используя программное обеспечение ImageJ, квадрат размером 100 × 100 мкм помещали на каждое изображение с 60-кратным увеличением, и все аксоны в пределах квадрата (0,01 мм 2 ) подсчитывали с использованием функции порогового значения и анализа частиц на изображении J.Среднее количество аксонов на 6-8 изображениях использовалось для расчета плотности аксонов / мм 2 зрительного нерва. Счетчики не видели экспериментальных групп.

Иммуногистохимия кожи мыши

Образцы кожи спины фиксировали 4% параформальдегидом / PBS и держали на льду в течение 2 часов. Фиксированные образцы кожи помещали в ОКТ (Sakura Finetek) и мгновенно замораживали в жидком азоте для гистологии. После промывания в PBS неспецифическое окрашивание блокировали PBS, содержащим 3% обезжиренного молока и 0.1% Triton-X в течение 30 мин. Срезы инкубировали с первичными антителами при 4 ° C в течение ночи: крысиные антитела против CD117 мыши (BD Pharmingen) и кроличьи антитела против KRT5 человека (COVANCE). Вторичные антитела конъюгировали с Alexa Fluor 488 или 594 (Invitrogen). Ядра контрастировали 4 ’, 6-диамидино-2-фенилиндолом (DAPI), и изображения получали с использованием конфокального микроскопа FV1000 (Olympus). > 100 волосяных фолликулов на мышь (n = 8) анализировали на наличие KIT + меланоцитов в выпуклости.

Количественная оценка субэпидермальной толщины

Кожная ткань, подобранная по месту, была зафиксирована в формалине, залита парафином, и 5 мкм срезы были вырезаны и окрашены гематоксилином и эозином. Репрезентативные области подкожного слоя измеряли от границ дермы до panniculus carnosus («субэпидермиса») с помощью окулярного микрометра. Были приняты меры для обеспечения того, чтобы ткань была встроена перпендикулярно, и определение толщины подкожного слоя не было искусственно улучшено из-за тангенциального разреза. Поскольку субэпидермальный слой достиг максимальной толщины у контрольных мышей Cre в 17-18 месяцев, этот момент времени был выбран для сравнения с мышами ICE.Для каждого среза ткани было произведено не менее 10 случайно выбранных определений толщины.

Иммуногистохимия мозга

Для окрашивания GFAP и Iba1 ткани инкубировали в течение ночи в параформальдегиде (4% об. / Об.). Фиксированный мозг заливали парафином, и срезы размером 6 мкм получали с помощью ручного ротационного микротома (Leica). После депарафинизации и регидратации тканевых слайдов выполняли этап выявления антигена с использованием раствора для демаскировки антигена (Vector).Срезы блокировали в PBS с 5% BSA и 0,3% Triton-X при 4 ° C в течение 1 часа и инкубировали с первичными антителами в PBS с 2% BSA и 0,1% Triton-X при 4 ° C в течение ночи с кроличьими антителами против GFAP. (Abcam, ab7260), кроличьи антитела против Iba1 (Funakoshi, GTX100042). Использовали вторичные антитела, конъюгированные с Alexa Fluor 488 или 594 (Invitrogen), с последующим окрашиванием DPAI. Чтобы локализовать экспрессию I -Ppo I и повреждение ДНК, мышей перфузировали транскардиально и мозг фиксировали в течение ночи 4% параформальдегидом / PBS, затем очищали 30% раствором сахарозы.Мозг встраивали в ОКТ (Sakura Finetek), и срезы размером 40 мкм собирали с помощью криостата (Leica). Срезы блокировали в сыворотке лошади / TBS-Triton-X в течение 30 мин при комнатной температуре, а затем инкубировали с первичными антителами в течение ночи при 4 ° C с козьими анти-GFP (Abcam) и кроличьими анти-γ-h3AX (Cell Signaling). Вторичные антитела конъюгировали с Alexa Flour 488 и 647 (Jackson ImmunoResearch) и совместно окрашивали DAPI.

Измерение АТФ и мтДНК

Замороженную ткань на короткое время промывали PBS и к ткани добавляли 3 мл насыщенного фенола Tris-HCl TE на 100 мг с последующей гомогенизацией в гомогенизаторе ткани (Omni TH, Omni). После центрифугирования клеточные лизаты добавляли к равному количеству насыщенного ТЕ фенола, хлороформа и воды добавляли в ту же пробирку. После центрифугирования супернатант использовали для измерения АТФ и мтДНК. АТФ измеряли с помощью набора АТФ (ThermoFisher Scientific) и нормализовали по массе ткани. Геномную ДНК и мтДНК очищали 2,5-кратным этанолом и гликогеном. Праймеры для рибосомы 18S и CytB использовали для расчета отношения мтДНК к геномной ДНК. Праймерами были: 18S мыши, 5‘-TGTGTTAGGGGACTGGTGGACA-3 ’(прямой) и 5’-CATCACCCACTTACCCCCAAAA-3 ’(обратный), Cytb мыши, 5’-CCCTAGCAATCGTTCACCTC-3 ’-3’-3 ’-TGGGTCTCCTAG (обратный).

Испытание в открытом поле

Мышей помещали в центр камеры (48,5 см × 48,5 см), закрытой занавеской. Исследование новой среды оценивали, давая мышам возможность исследовать в течение 5 минут. Исследовательская активность на периферии и общая активность регистрировались с помощью системы видеонаблюдения и анализировались с помощью TopScanLite версии 2.

Тест на обусловленность контекстом страха

Условие условного страха оценивалось с помощью системы TSE. В день 1 мышей помещали в экспериментальный бокс (52 см × 52 см × 65 см) и позволяли свободно исследовать в течение 180 с, а затем 0.Удар током 5 мА в течение 1 с. Еще один разряд 0,5 мА в течение 1 с давали через 30 с и немедленное замораживание измеряли каждые 10 с визуальным счетом, после чего мышей возвращали в их домашнюю клетку. Контекстное замирание без тонального сигнала оценивалось в течение 180 секунд, через 24 часа после шока, считая замирания каждые 10 секунд.

Тест лабиринта Барнса

Лабиринт состоял из круглой белой платформы (диаметром 90 см) с отверстиями диаметром 20 × 5 см, расположенными по краю платформы на высоте 82 см над полом.Для визуальных подсказок платформу окружали четыре картинки разного цвета и формы. Мышь помещалась в центр лабиринта, а затем мышь направлялась в небольшую камеру, называемую целевым отверстием, в период адаптации. Через 2 мин нахождения в целевой лунке мышь возвращали в клетку. Во время периода пространственного захвата мыши позволяли исследовать целевую лунку в течение 3 минут. Если мышь вошла в целевую лунку или прошло 3 минуты, мышь оставалась в лунке на 1 минуту. Испытание повторяли 3 раза в день в течение 5 дней.Для проверки долговременной памяти через 7 дней был проведен пробный зонд, прикрыв целевое отверстие крышкой. Мыши позволяли исследовать положение целевой лунки в течение 90 секунд, и количество толчков в каждой лунке измеряли с помощью TopScanLite версии 2.

Тест силы захвата, тест на беговой дорожке и измерение лактата

Для измерения мышечной силы мышь была удерживалась за хвост и позволяла захватить сетчатую рукоятку передними лапами (BIO-G53, BIOSEB), затем тянула назад, пока рукоятка не была освобождена.После 10-минутного перерыва эксперимент повторили. Максимальная выносливость при физической нагрузке оценивалась с помощью системы беговой дорожки (TSE). Мышей обучали в течение 3 дней перед записью производительности для ознакомления мышей с оборудованием. Сетка электростимуляции была настроена на 1 мА, а наклон был установлен на 15 градусов. В первый день тренировки мыши ходили по беговой дорожке со скоростью 10 м / мин в течение 10 минут с 10-минутным перерывом, затем шли со скоростью 10 м / мин в течение 10 минут. На второй и третий день первые два шага были такими же, как в первый день, затем была начата ходьба со скоростью 10 м / мин и скорость увеличивалась на 1 м / мин каждую минуту до максимальной скорости 20 м / мин.На 4-й день измеряли максимальную выносливость при физической нагрузке. Шесть мышей были помещены на беговую дорожку, и скорость ленты была увеличена до 5 м / мин в течение 5 минут, чтобы дать мышам возможность разогреться. Скорость увеличена на 1 м / мин до 20 м / мин. После 5-минутного пробега скорость была увеличена с 20 м / мин до 21 м / мин в течение 10 минут. Затем мышей заставляли бегать со скоростью 22 м / мин, пока они не оставались на сетке электростимуляции в течение 10 секунд. Подробности высылаются по запросу. Отбирали кровь из хвоста перед тренировкой и после нее, и уровень лактата в сыворотке измеряли с помощью лактатметра (Nova Biomedical).

Амбулаторная деятельность

Животные содержались в помещении, свободном от специфических патогенов (SPF), и содержались по одному в оборудованных индивидуально вентилируемых клетках (IVC) (Digital Smart House, Виум, Сан-Матео, Калифорния, и Innovive, Сан-Диего, Калифорния ), содержащий подстилку из початков кукурузы с доступом к Innowheel и Innodome (Innovive, Сан-Диего, Калифорния), Bed-r’Nest (Andersons Lab Bedding, Maumee, Огайо) и смеси для кормления (Veggie Relish, LabDiet). Животные имели неограниченный доступ к пище (Pico Rodent Diet 5053, Lab Diet, St.Луис, Миссури) и подкисленной стерильной водой (Innovive, Сан-Диего, Калифорния). Цифровые умные дома Vium, встроенные в фирменную стеллажную систему Vium, были оснащены датчиками и камерой высокой четкости (HD), которая обеспечивает непрерывный круглосуточный мониторинг животных и передает данные в безопасную облачную инфраструктуру. Как описано в другом месте (Lim et al., 2019; Lim et al., 2017), видео обрабатывается с использованием алгоритмов компьютерного зрения для создания цифровой истории движения (мм / сек). Движение (мм / с) было усреднено по ячейкам за 1 час, чтобы получить средние значения за 1 час.Все средние значения за 1 час с 6 утра до 7 утра за 55 дней были усреднены и повторены для каждого часа дня.

Полногеномное секвенирование (WGS)

Геномную ДНК выделяли из быстро замороженных тканей с использованием набора DNeasy для крови и тканей и фрагментировали с помощью ультразвукового прибора Covaris на пике 500 п.н. Наборы для приготовления библиотеки TruSeq DNA без ПЦР использовали для добавления ДНК-адаптеров к дцДНК в соответствии с инструкциями производителя (Illumina). Глубокое секвенирование всего генома (50X) на платформе Illumina Hiseq X10 было выполнено в BGI (Китай).

Анализ походки на беговой дорожке

Образцы походки были измерены с использованием принудительной ходьбы на беговой дорожке (Columbus Instruments; Колумбус, Огайо). Высокоскоростная цифровая видеокамера записывала изображения брюшной стороны мыши через прозрачную беговую дорожку, отражающуюся от зеркала. Мыши в течение примерно 24 секунд со скоростью 13, 19 и 25 см / с. Программное обеспечение TreadScan® (CleverSys, Inc, Рестон, Вирджиния) идентифицировало каждую отдельную лапу мыши в каждом кадре, когда она шла по беговой дорожке, и, среди прочего, оценивались показатели положения и продолжительности движения.

ЦОГ и окрашивание плотности капилляров

Свежевыделенные четырехглавые и икроножные мышцы помещали в OCT (Tissue-Tek), помещали в изопентановую ванну и медленно охлаждали в жидком азоте. Поперечные срезы (20 мм) делали на криостате (Leica). Срезы фиксировали в предварительно охлажденном ацетоне (-20 ° C) в течение 10 мин, промывали PBS, затем блокировали BlockAid (Invitrogen) в течение 1 ч при комнатной температуре, а затем инкубировали с CD31 (ab56299, Abcam), ламинином (L9393, Sigma) антитела, разведенные в блокирующем буфере в течение ночи при 4 ° C. Срезы промывали PBST, затем инкубировали с антикрысиным Alexa Fluor 488 (Life Technologies) и антикроличьим Alexa Fluor 594-конъюгированным (Life Technologies), разведенными до 1: 500 в блокирующем буфере в течение 2 часов при комнатной температуре. Слайды снова промывали PBST и закрепляли с помощью Fluoroshield с монтажной средой DAPI (Sigma). Изображения были получены с использованием конфокального флуоресцентного микроскопа (Nikon A1). Окрашивание ЦОГ проводили согласно протоколу (Росс, 2011). Вкратце, 20 мкм криостатные срезы сушили при комнатной температуре в течение 1 часа и среду, содержащую 1X DAB, 100 мкМ цитохрома c, 2 мкг / мл бычьей каталазы, добавляли к срезам, и слайды инкубировали при 37 ° C в течение 40 минут.Количественное определение числа и плотности капилляров проводили с помощью ImageJ.

Электронная микроскопия

Мышей в возрасте 15 месяцев анестезировали изофлураном и умерщвляли смещением шейки матки или декапитацией в соответствии с имеющимися этическими разрешениями. Мышцы собирали и фиксировали фиксатором для электронной микроскопии (состоящим из 3% глутаральдегида, 2,5% параформальдегида, 2 мМ хлорида кальция, 2% сахарозы в 0,1 М какодилатном буфере), и ткань обрабатывали, как сообщалось ранее (Le Couteur et al., 2001). Использовали два блока из разных частей мышцы, и из каждого раздела были сделаны 10 изображений с увеличением 5000X на просвечивающем микроскопе Jeol 1210 и сфотографированы с помощью цифровой камеры Gatan US 4000MP.

Митохондриальная сеть, размер и количество были подсчитаны вслепую с помощью FUJI ImageJ.

Количественная ПЦР в реальном времени для транскрипции повторяющихся элементов

Общую РНК выделяли из 30-50 мг ткани с использованием реагента Trizol (ThermoFisher) в соответствии с инструкциями производителя.Перед синтезом кДНК общая РНК была расщеплена 27,2 единицами Кунитца ДНКазы, не содержащей РНКаз (Qiagen), в течение 45 минут при комнатной температуре и дополнительно очищена на колонках RNeasy (Qiagen) (De Cecco et al. , 2013). Эффективность переваривания оценивали с использованием контролей, в которых не учитывалась обратная транскриптаза (RT). Расщепление ДНКазой повторяли до тех пор, пока контроль без RT не стал отрицательным для γ-сателлитных последовательностей. Целостность РНК определяли с использованием Agilent Bioanalyzer 2100 и РНК-наночипа.Общая РНК (1 мкг) транскрибировалась в кДНК в реакциях объемом 50 мкл с использованием набора TaqMan Gold RT-PCR (Applied Biosystems) и случайных гексамеров в соответствии с протоколом производителя. Эту реакцию (1,0 мкл) использовали в последующих реакциях количественной ПЦР, проводимых с использованием системы SYBR Green (Applied Biosystems) в системе реального времени ViiA 7 (Applied Biosystems) в соответствии со спецификациями производителя. Праймеры использовали в конечной концентрации 300 нМ. Ткани 6 отдельных животных анализировали в трех повторностях.Статистический анализ проводился с использованием t-критерия Стьюдента и SigmaPlot 12.5 (программное обеспечение Systat).

Дизайн праймеров ПЦР для повторяющихся элементов

Все праймеры, использованные в этом исследовании, перечислены в таблице S1. Для анализа экспрессии LINE-1, MusD и перицентромерных γ-сателлитных последовательностей (MSAT) мы использовали праймеры, описанные Changolkar et al. (Changolkar et al., 2008). Праймеры для SINE-элементов B1 и B2 были сконструированы с использованием консенсусной последовательности из Repbase (Институт исследования генетической информации, www.girinst.org/repbase/index.html) и программное обеспечение Primer-Blast (www.ncbi.nlm.nih.gov/tools/primer-blast/). Праймеры против GAPDH и β-актина, используемые в качестве контролей для нормализации, были созданы с помощью Primer-Blast с использованием эталонных последовательностей NCBI NC_000072.6 и NM_007393.3 соответственно. Последовательности праймеров анализировали с помощью инструмента ПЦР UCSC genome browser in silico (genome.ucsc.edu/cgi-bin/hgPcr) для определения количества геномных элементов, которые вносят вклад в продукты амплификации (De Cecco et al. , 2013). Все праймеры тестировали с серийными разведениями кДНК, чтобы убедиться, что они количественно амплифицируют свои целевые последовательности.

Анализ мышечной РНК-seq

Считывание парных концов РНК-последовательности икроножной мышцы было сопоставлено с построением генома UCSC mm10 с использованием HISAT2 версии 2.1.0 (Kim et al., 2015). Функция featureCounts из пакета Rsubread (Rsubread 1.32.2) использовалась для сбора счетчиков чтения для генов. DESeq2 (DESeq2 1.22.2) был применен для анализа дифференциальной экспрессии для всех генов с rowSums> = 10.

Для сравнения экспрессии генов в икроножных мышцах ICE, Cre и WT из объединенного набора данных DESeq была экспортирована таблица нормализованных показателей считывания со всеми повторами и условиями. Были отобраны 200 генов с наименьшим скорректированным значением p для дифференциальной экспрессии между Cre и ICE и упорядочены по разнице в log2-кратном изменении между Cre и Ice. Функция R heatmap.2 (gplots 3. 0.1) была использована для построения графика значений Z-score для каждого гена.

Эпигенетические часы (возраст ДНК)

Образцы тканей немедленно сохраняли в DNA / RNA Shield ™ (Zymo Research; Cat.№ R1100-50) и геномную ДНК очищали с использованием набора Quick-DNA Plus (Zymo Research; № по каталогу D4068) в соответствии с инструкциями производителя. Подготовка библиотеки образцов и анализ данных были выполнены Zymo Research, CA. Вкратце, геномную ДНК (200 нг) превращали в бисульфит с использованием набора EZ DNA Methylation-Lightning ™ (Zymo Research; каталожный № D5030).

Библиотеки ДНК, преобразованные бисульфитом, для целевой платформы бисульфитного секвенирования, называемой SWARM ® (упрощенный метод реакции амплификации на всей панели), были подготовлены в соответствии с инструкциями производителя, затем секвенированы на секвенаторе HiSeq 1500 с охватом> 1000X.Считывания последовательностей идентифицировали с использованием программного обеспечения для определения базовых последовательностей Illumina и выравнивали с эталонным геномом с использованием Bismark (http://www. bioinformatics.babraham.ac.uk/projects/bismark/), выравнивателя, оптимизированного для данных бисульфитных последовательностей и вызовов метилирования. Уровень метилирования каждого отобранного цитозина оценивался как количество считываний, сообщающих о C, деленное на общее количество считываний, сообщающих о C или T. Уровни метилирования ДНК> 500 возрастных локусов CpG были использованы для прогнозирования возраста с использованием эпигенетического возраста. алгоритмы.

Дополнительная информация

Таблица S1. Праймеры, использованные в этом исследовании, относящиеся к рисункам 1, 2 и 5

Таблица S2. Дифференциальные гены из мышечной РНК-seq, относящиеся к Фигуре 7

Таблица S3. Значения метилирования ДНК эпигенетических часов CpG, относящиеся к рисунку 7

БЛАГОДАРНОСТИ

Эта статья посвящена памяти нашего коллеги и соавтора Нормана С. Вольфа. Благодарим всех сотрудников лаборатории Sinclair за конструктивные комментарии. Мы благодарим Эдварда Шулака за финансовую поддержку и поддержку, Андреа Ди Франческо, Фу Хуин, Кристала Калафута, Эрин Уэйд и Рафаэля де Кабо (Национальный институт старения) за технические советы и Алекса Бэнкса (Медицинский центр Бет Исраэль) за помощь в проведении МРТ. При поддержке NIH / NIA (R01AG019719 и R37AG028730 для DAS), Фонда Гленна для медицинских исследований (для DAS и AJW), Human Frontier Science Program (от LT000680 / 2014-L до MH), JSPS KAKENHI (17K13228, 19K16619 и 19H05269 по MH05269 ), Мемориальный фонд Уэхара (для MH), Национальный исследовательский фонд Кореи (2012R1A6A3A03040476 для J.-HY), NIH T32 (T32AG023480 для DLV), NIA K99 / 00 (от K99AG055683 до JMR), NEI (от RO1EY019703 до TCJ) и Фонд Святого Винсента де Поля (BRK).

ССЫЛКИ

  1. 33
  2. 9033 909
  3. 90↵1 934 Gart 90↵1 934 934 934 934 934 934 934 934 9349Э., Дарши, М., Грин, С.Дж., Гур, Р.С., Лин, Л., Масиас, Б.Р., Маккенна, М.Дж., Мейдан, К., Мишра, Т., Насрини, Дж. И др. (2019). Исследование близнецов НАСА: многомерный анализ годичного полета человека в космос. Science (Нью-Йорк, Нью-Йорк) 364.

  4. 90↵34 9033 90 9034 9033 9034 9034 9034 9034
  5. 9033 9034 9034 9034 9034 90 ↵
  6. ↵ 90↵33 9034 90↵34 90↵34 9034 9034 9034
  7. 9033 909
  8. ↵ 90↵33 9034 90↵34 90↵34 9034 9034 9034
  9. C. Х. (1957). Стратегия генов; обсуждение некоторых аспектов теоретической биологии (Лондон: Allen & Unwin).

  10. 909 K. Kim, J., Hess, JM, Kübler, K., Grimsby, J., Frazer, R., Zhang, H., Haradhvala, NJ, Rosebrock, D., et al. (2019). Анализ последовательности РНК показывает макроскопическое соматическое клональное расширение в нормальных тканях.Science (Нью-Йорк, Нью-Йорк) 364, eaaw0726.

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie.Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или уточнить у системного администратора.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

JDB | Бесплатный полнотекстовый | За пределами сердца млекопитающих: рыбы и земноводные как модель восстановления и регенерации сердца

Сердца рыб и земноводных, хотя и сильно различаются по грубой морфологии, имеют много общего друг с другом и с сердцами млекопитающих. Сердце позвоночных состоит из трех основных слоев — эндокарда, эндотелиального слоя, выстилающего внутренний просвет сердца; миокард, мышечный слой; и эпикард, защитный слой эпителиальных клеток, покрывающий внешнюю часть миокарда.Сам миокард состоит из двух слоев: компактного миокарда, который формирует стенки сердца, и трабекулярного миокарда, который формирует сократительные трабекулы внутри камер сердца [21,24]. Кроме того, общий паттерн развития сердца хорошо сохраняется у позвоночных: симметричная пара nkx2.5-положительных мезодермальных регионов, известных вместе как поле сердца, помогает установить популяцию сердечных клеток-предшественников. На раннем этапе развития эти поля перемещаются к средней линии организма и сходятся, образуя линейную сердечную трубку.Затем эта трубка принимает S-образную форму, поскольку клетки вдоль ее оси дифференцируются на клетки предсердий и желудочков. Тем временем экстракардиальные популяции клеток мигрируют к сердцу, чтобы сформировать эндокард и эпикар. У рыб не происходит дальнейшей перегородки камеры; у амфибий атриум разделяется на две части. Оба таксона имеют только один желудочек, в отличие от млекопитающих [57]. При таком сходстве в развитии и морфологии регенерация сердца следует в высшей степени стереотипному поведению, независимо от вида или большинства способов повреждения.В течение первых часов или дней после травмы сгусток крови начинает закрывать рану, после чего следует воспалительная реакция, которая приводит к отложению коллагена и фибринового внеклеточного матрикса (ЕСМ) фибробластами, происходящими из эпикарда. Затем кардиомиоциты за пределами зоны повреждения частично дедифференцируются, чтобы повторно войти в клеточный цикл, пролиферировать и мигрировать к месту раны. Фиброзный материал, заполняющий рану, заменяется в течение следующих дней или недель функциональными кардиомиоцитами (суммированными в таблице 1).В зависимости от конкретной изученной модели повреждений могут потребоваться дополнительные шаги. Например, криоповреждение, которое воспроизводит эффекты инфаркта, приводит к некротической ткани, которую необходимо очистить, прежде чем фиброз и регенерация могут продолжаться [35]. И наоборот, некоторые методы повреждения могут не потребовать выполнения некоторых из этих действий во время ремонта. Генетическая абляция Z-CAT, например, приводит к минимальному отложению коллагена [41].

Основные процессы, участвующие в регенерации сердца — активация эпикарда, фиброз и кардиомиоцитарные процессы, включая дедифференцировку, пролиферацию и миграцию — описаны более подробно ниже.Большинство конкретных результатов было получено на рыбках данио, хотя эксперименты с амфибиями показали, что многие из этих процессов сохраняются во всех таксонах позвоночных. Если процесс регенерации отличается у других организмов, это особо отмечается.

3.1. Epicardial Activation
Ключевым компонентом регенерации сердца у многих видов и моделей повреждений является роль эпикарда. Эпикар и производные от него типы тканей играют важную роль в развитии сердца, где клетки, происходящие из эпикарда (EPDC), дифференцируются в многочисленные типы клеток, включая гладкие мышцы коронарных сосудов и фибробласты [64]. Во время регенерации сердца эпикардиальные процессы включают реактивацию онтогенетических генов в эпикардиальных клетках и трансдифференцировку эпикардиоцитов в другие типы клеток, необходимые для протекания регенерации, включая фибробласты. Активация эпикарда начинается с повторной экспрессии wt1, маркера стволовых клеток и, в частности, развивающегося эпикарда, а также других генов развития эпикарда, таких как raldh3 (необходим для синтеза ретиноевой кислоты) и tbx18, все в течение первых 1-2 дней после травмы. .Raldh3 наиболее активен во время ранней регенерации; он сначала экспрессируется в эпикарде предсердий и желудочков через несколько дней после травмы, локализуется в месте повреждения через одну неделю и уменьшается через две недели после травмы. Между тем, экспрессия tbx18 сохраняется намного дольше, по крайней мере, через месяц после травмы [24,35,59,65,66]. Регенерация самого эпикарда происходит относительно рано в процессе регенерации, происходя до того, как восстановление миокарда станет видимым [22 ]. Активированные эпикардиальные клетки начинают пролиферировать примерно через три дня после травмы, а через две недели эпикард охватывает поврежденную область, обеспечивая защиту и поддержку регенерации миокарда [59,67].Приблизительно через неделю после травмы эпикардиальные клетки активируют экспрессию snail2 и twist1b, маркеров эпителиально-мезенхимального перехода (EMT), при подготовке к трансдифференцировке [68]. Через 2 недели после травмы активированные эпикардиальные клетки затем проникают в миокард, где они подавляют экспрессию wt1 и дифференцируются в различные типы клеток EPDC [65]. Некоторые из них мигрируют в регенерирующую коронарную сосудистую сеть, чтобы стать сосудистыми перицитами и организовать неоваскуляризацию, процесс, опосредованный тромбоцитарным фактором роста (PDGF) и фактором роста фибробластов (FGF) [59,65,68,69].Другие экспрессируют фибронектин и трансдифференцируются в фибробласты, которые проникают в место повреждения, сначала откладывая коллаген, а затем способствуют миграции кардиомиоцитов в рану для замещения фиброзной ткани [42]. Одним из важных типов клеток, не включенных в этот список, являются кардиомиоциты; эпикардиальные клетки, которые подвергаются EMT, впоследствии не экспрессируют маркеры дифференцировки миокарда, такие как тяжелая цепь миозина (MHC) или cmlc2. Точно так же они не экспрессируют эндотелиальный маркер fli1, указывая на то, что эндокард также не входит в число потенциальных судеб EPDC [65,69].
3.2. Дедифференцировка и пролиферация кардиомиоцитов
Для регенерации поврежденного или инфаркта миокарда необходимо произвести новые кардиомиоциты; откуда же они? Ранние исследования регенерации сердца у рыбок данио показали, что кардиомиоциты, участвующие в регенерации отсутствующего миокарда, были сформированы посредством дифференцировки недифференцированной популяции клеток-предшественников [59]. Однако последующие эксперименты показали, что все регенерированные кардиомиоциты происходят из существующих кардиомиоцитов [60,61].Поскольку взрослые кардиомиоциты в основном находятся в состоянии покоя, регенерация требует, чтобы они повторно вошли в клеточный цикл, который частично контролируется киназами митотических контрольных точек Mps1 и Plk1. Ингибирование любой из этих киназ предотвращает замещение миокардом фиброзной ткани и приводит к необратимому рубцеванию [21,60]. Также для пролиферации необходим белок щелевого соединения Cx43. Mps1 и Cx43, наряду с многочисленными другими регуляторами клеточного цикла, структурными белками и генами, связанными с кардиомиопатией, регулируются miRNA miR-133, подавление которой важно для создания разрешающей среды для продолжения пролиферации кардиомиоцитов [70].Повторный вход кардиомиоцитов в клеточный цикл также требует дедифференцировки и повторной экспрессии нескольких генов сердечного развития [59,61]. Вопрос о том, какие гены реактивируются и в какой степени происходит дедифференцировка, неясен. Некоторые группы сообщили об экспрессии генов раннего развития nkx2.5, hand2, tbx5, tbx20 и mef2 в регенерирующих сердцах [40,59], тогда как другие не наблюдали экспрессии этих генов [28,60]. Gata4, ген раннего сердечного развития и один из основных маркеров этого процесса дедифференцировки, напротив, неоднократно наблюдался как у рыб, так и у земноводных [26,61,71]. Экспрессия Gata4 повторно индуцируется в клетках внешнего компактного миокарда, преимущественно вблизи места повреждения, и именно эти клетки gata4 + пролиферируют и заполняют место раны [61]. В регенерирующем миокарде также активируется ген гомеобокса msx, ген, который регулирует регенерацию у разных видов и органов, включая конечности тритона и плавники рыбок данио. Однако msx не активируется в развитии сердца, указывая на то, что процесс регенерации является более сложным, чем просто повторение сердечного развития [28].Морфологически дедифференцировка видна как в кардиомиоцитах рыб, так и в кардиомиоцитах амфибий в виде дезорганизованных саркомеров, потери межклеточной сплоченности, округления формы клеток и подавления активности сердечных белков терминальной дифференцировки, таких как миозин и тропонин [27,40,41,59,60 , 72]. В меньшем количестве экспериментов изучали экспрессию генов у земноводных во время регенерации сердца, но один из тех, который показал увеличение nkx2. 5, hand2, gata4, gata5 и islet1 [26], последний из которых не наблюдался в сердце рыб. регенерация [40].Эта комбинация пролиферации и дедифференцировки указывает на эпиморфную регенерацию, при которой недифференцированная бластема формируется в месте повреждения и подвергается дифференцировке для замещения отсутствующей или поврежденной ткани. У рыбок данио это проявляется как накопление высокопролиферативных бластемальных клеток, экспрессирующих эмбриональные маркеры, в непосредственной близости от зоны инфаркта, начиная с 4 дней после травмы. В дополнение к этому немедленному локальному ответу также наблюдается усиление пролиферации остальной части неповрежденного сердца, которая сохраняется на более поздних стадиях регенерации.Распределение митотических клеток смещается от области инфаркта по мере прогрессирования регенерации, возможно, указывая на то, что более поздние фазы регенерации связаны с системной репарацией в масштабе сердца [58]. Это позднее увеличение пролиферации на весь желудочек также наблюдалось в сердце тритона во время регенерации [67]. Одним особенно интересным источником кардиомиоцитов во время восстановления желудочков, наблюдаемым как у земноводных, так и у рыб, является предсердие. Пролиферация миокарда предсердий в ответ на повреждение желудочков впервые наблюдалась у тритона, Notophthalmus viridescens, где на самом деле пролиферация была более распространена в предсердии, чем в желудочке [16].Другой вид земноводных, аксолотль Amblystoma mexicanum, показал сопоставимое увеличение митоза предсердий во время регенерации желудочка [20]. У рыбок данио реакция предсердий видна даже до того, как происходит увеличение пролиферации. Raldh3 активируется в эндокарде предсердий в течение часа после повреждения желудочка, за несколько часов до того, как он активируется в желудочке [24]. Через один день после травмы активация неповрежденного эпикарда предсердия начинается одновременно с активацией поврежденного желудочка с экспрессией raldh3 с последующей активацией tbx18.Однако экспрессия этих маркеров вскоре ограничивается областью, непосредственно прилегающей к желудочковой ране. Между тем, рецептор фактора роста фибробластов (fgfr), связанный с миграцией кардиомиоцитов в рану, активируется непрерывными участками по всему эпикарду предсердий [59]. Эти данные свидетельствуют о том, что активация всех трех слоев предсердия участвует в регенерации сердца. Роль кардиомиоцитов предсердий в регенерации желудочков была подтверждена у рыбок данио с использованием модели клеточной абляции.Когда кардиомиоциты желудочков удаляются, кардиомиоциты предсердий дедифференцируются в клетки-предшественники сердца. Эти клетки демонстрируют неорганизованную структуру, сниженную экспрессию маркеров терминальной дифференцировки, таких как MHC, и повторную экспрессию онтогенетических генов, включая gata4, hand2, nkx2.5, tbx5a, tbx20 и mef2. Затем клетки-предшественники вновь приобретают желудочковые идентичности, мигрируя в желудочек, чтобы стать зрелыми кардиомиоцитами желудочков. Процесс миграции зависит от передачи сигналов Notch, и активация как компонентов пути Notch, так и raldh3 происходит в эндокарде предсердий, указывая на возможную роль ретиноевой кислоты (RA) также [40]. Помимо своей роли в активации эпикарда, RA необходим для пролиферации кардиомиоцитов. Raldh3 активируется воспалительной реакцией в эндокарде предсердий и желудочков в течение нескольких часов после травмы и в течение суток локализуется в месте повреждения. Эти raldh3-положительные клетки также обогащены экспрессией генов развития сердца hand2 и gata5. Наряду с raldh3-положительными эпикардиальными клетками эндокард составляет один из двух основных источников RA во время регенерации сердца.Ингибирование передачи сигналов RA от эндокардиальных и эпикардиальных клеток значительно снижает вызванную повреждением пролиферацию кардиомиоцитов. Однако сверхэкспрессия RA не влияет на уровни пролиферации, указывая на то, что передача сигналов RA необходима, но недостаточна для правильной пролиферации кардиомиоцитов [24]. Эндокард также отвечает за продукцию интерлейкина 11a (Il11a), лиганда сигнальной системы Jak1 / Stat3. Jak1 / Stat3, экспрессируемый в миокарде, и его нижестоящие эффекторы, вероятно, участвуют в выживании клеток во время ранней, ранозаживляющей части регенерации и необходимы для более поздней пролиферации кардиомиоцитов [73]. Ряд других паракринных и юкстакринных сигнальных путей, охватывающих все три слоя сердца, также необходим для пролиферации кардиомиоцитов. К ним относятся PDGF [74], Hedgehog, инсулиноподобный фактор роста (IGF), TGF-β и Notch [43]. Sonic hedgehog (Shh) активируется в эпикарде, прилегающем к травме, при этом маркеры активности Shh наблюдаются в соседних кардиомиоцитах. IGF экспрессируется в эндокарде, а его рецептор находится в поврежденном миокарде [43]. TGF-β присутствует в миокарде, эпикарде и фибробластах [37].Рецептор Notch, тем временем, активируется как в эндокарде, так и в эпикарде, но остается отсутствующим в промежуточном миокарде [71]. Паттерн экспрессии лигандов Notch изучен хуже; Был исследован только deltaC, экспрессируемый в эндокарде вместе с изоформой notch2b. Рецептор Notch экспрессируется в сердце от 1 дня до 1 недели после травмы, после чего активность гена снижается [28]. Передача сигналов Notch необходима для пролиферации кардиомиоцитов; когда он подавляется во время более позднего периода экспрессии Notch (6-7 дней после травмы), рана остается фиброзной, и регенерация миокарда никогда не происходит. Интересно, что гиперактивация передачи сигналов Notch также предотвращает пролиферацию кардиомиоцитов, указывая на то, что для правильного протекания регенерации необходим очень специфический уровень передачи сигналов [71]. В нескольких экспериментах in vitro на культивируемых кардиомиоцитах тритона были дополнительно уточнены факторы, необходимые для повторного входа в клеточный цикл миоцитов. и распространение. Основной ограничивающей точкой в ​​начале этого процесса является белок ретинобластомы (Rb), который в тканях дикого типа предотвращает переход клеток в S-фазу.Фосфорилирование Rb посредством циклин-зависимой киназы (Cdk) 4 и 6 дезактивирует это ограничение S-фазы и необходимо кардиомиоцитам тритона для входа в клеточный цикл [75,76]. Однако переход в S-фазу не гарантирует последующего распространения. В то время как большинство кардиомиоцитов способны вступать в S-фазу в культуре, только одна треть из них впоследствии завершает один или несколько циклов клеточного деления, причем большинство из них останавливается непосредственно перед митозом или перед цитокинезом [76]. Это разделение между повторным входом в клеточный цикл и пролиферацией подтверждается тем фактом, что хотя PDGF и IGF способствуют пролиферации кардиомиоцитов, они сами по себе не могут индуцировать терминально дифференцированные миоциты для повторного входа в клеточный цикл [75].Было также продемонстрировано, что множественные компоненты ВКМ вызывают пролиферацию кардиомиоцитов в культуре, включая ламинин, фибронектин [76] и тенасцин С [67].

Однако одного распространения недостаточно; после пролиферации кардиомиоцитов их необходимо заставить мигрировать в область раны. С этим процессом миграции кардиомиоцитов неразрывно связан фиброз, решающий этап регенерации сердца, который ликвидирует разрыв между ранним заживлением ран и более поздней регенерацией миокарда.

3.3. Фиброз и миграция кардиомиоцитов
Среди первых событий, необходимых для регенерации сердца, как части общей реакции заживления ран, являются свертывание крови, активация воспалительной реакции и фиброз. В моделях резекции и криовращения эти события происходят в первую очередь в течение первой недели после травмы. Свертывание крови начинается через несколько секунд после травмы, так как рана закупорена эритроцитами [21]. В течение первого дня активированные тромбоциты попадают в рану и в течение следующих недель экспрессируют PDGF, способствуя неоваскуляризации, и другие факторы, необходимые для регенерации [33,68].Начиная через 3 часа после травмы и продолжаясь в течение следующих нескольких дней, воспалительная реакция достигает пика, когда лейкоциты, включая макрофаги и миелопероксидаза-положительные нейтрофилы, начинают проникать в место раны [22,35,41,62,74]. Подавление воспалительной реакции приводит к снижению рекрутирования фагоцитов, нарушению ангиогенеза и уменьшению пролиферации кардиомиоцитов и, в конечном итоге, препятствует завершению регенерации [62]. В то же время в области повреждения начинается воспаление, апоптоз и / или некроз. области (или прилегающей к травме области в экспериментах по резекции), поскольку клеточный мусор в инфаркте убирается [33,35,36,63]. Одновременно с воспалением и инициированием апоптоза сгусток эритроцитов заменяется временным фибриновым матриксом, который сохраняет структуру в ране примерно до одной недели после травмы, когда временный матрикс лизируется для замены первичным коллагеновым матриксом и инициирует В фазе регенерации преобладает фиброз [21,36]. Фиброз или рубцевание — это процесс заживления раны, который включает замену отсутствующей или некротической ткани соединительной тканью, в первую очередь фибрином и коллагеном.В сердцах взрослых млекопитающих это единственный процесс, с помощью которого можно вылечить поражения или инфаркты, но постоянное рубцевание приводит к изменениям сократимости, проводимости и морфологии сердца, что может значительно снизить функцию сердца [33]. У организмов, способных регенерировать свое сердце, эта фиброзная ткань вскоре заменяется функциональным миокардом, и постоянных рубцов не остается. Хотя рубцевание и регенерация обычно рассматриваются как противоположные результаты, начальный период фиброза необходим для правильной регенерации как у рыб, так и у земноводных, обеспечивая основу в виде внеклеточного матрикса для сборки кардиомиоцитов в рабочие мышцы [37,63,67]. В период фиброза активируется ряд генов заживления ран, таких как vegf, способствующий васкуляризации, и гранулин А, способствующий росту клеток [74]. Для завершения регенерации вновь пролиферирующие кардиомиоциты должны иметь возможность мигрировать в поврежденную область, и одновременно с этим необходимо удалить фиброзную ткань. Таким образом, начиная с одной недели, активируются ремоделирующие белки, такие как матриксные металлопротеиназы (ММП), и начинается разрешение фиброза [74].Путь передачи сигналов TGF-β является важным компонентом как установления, так и разрешения фиброза. Во время регенерации сердца рыбок данио в течение первых двух недель после травмы TGF-β экспрессируется в миокарде, эпикарде и фибробластах поврежденной области и границы инфаркта, но не обнаруживается в эндокарде. [37,41] Также присутствуют множественные изоформы рецептора TGF-β, а зона инфаркта и прилегающая ткань демонстрируют маркеры активности TGF-β в виде фосфорилированного Smad3 [37].TGF-β необходим как на ранней, так и на поздней фазах регенерации сердца. В течение первых двух недель для индуцирования фибробластов в основном необходимо депонировать фибронектин и коллаген в месте повреждения, образуя ECM, который обеспечивает основу для последующей регенерации мышц. Ингибирование передачи сигналов TGF-β через две недели не влияет на коллагеновый матрикс, но предотвращает инфильтрацию кардиомиоцитов и замену фиброзного ECM. TGF-β регулирует экспрессию гликопротеина тенасцина C на границе инфаркта, что, в свою очередь, необходимо для ремоделирования ECM и миграции кардиомиоцитов в область раны.[37] Фибронектин также может играть роль в этом процессе миграции, поскольку он, по-видимому, необходим для передачи сигналов кардиомиоцитам, экспрессирующим рецептор интегрина, и его ингибирование предотвращает регенерацию [42]. Эта роль ECM в управлении регенерацией сохраняется у земноводных, где фибронектин, тенасцин C и гиалуроновая кислота активируются в области раны на протяжении всей регенерации, а в случае последних двух — до 70 дней после травмы [67]. У рыб мигрирующие кардиомиоциты в первую очередь направляются системой хемокинов Cxcl12-Cxcr4 [66] и строят новый миокард в травмированной области снаружи раны (апикальный край миокарда) внутрь [33,59].Новые кардиомиоциты начинают электрически связываться примерно через 14 дней после травмы и полностью соединяются через 30 дней [36,61]. Передача сигналов FGF также необходима для правильной регенерации и устранения рубцов. FGF секретируется клетками миокарда, прилегающими к месту повреждения. Этот процесс активирует эпикардиальные клетки, экспрессирующие рецептор FGF, и необходим для замещения коллагенового рубца миокардом; хотя механизм этого сигнального процесса не охарактеризован, сходство в действии с ингибированием TGF-β предполагает, что роль FGF в эпикардиальной активации может следовать схожим путем [59].Интересно, что если передача сигналов FGF ингибируется, чтобы предотвратить регенерацию и вызвать рубцевание, процесс рубцевания может быть частично обращен вспять более поздним восстановлением FGF.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *