Масса нива ск 5: Страница не найдена — Трактор-РЕВЮ

Содержание

Комбайн Нива (модели СК-5 и СК-5М): преимущества и недостатки

Комбайн Нива СК-5

Содержание:

Комбайн Нива модели СК-5 — незаменимый труженик полей. Технические характеристики позволяют этому агрегату вполне уверенно выдерживать конкуренцию с западными моделями сельскохозяйственных машин. И даже превосходить их по многим показателям.

Общая информация

Самоходные зерноуборочные комбайны Нива впервые сошли с конвейера завода «Ростсельмаш» в 70-х годах прошлого века. Несмотря на прошедшие годы, этот комбайн до сих пор с успехом используется на полях нашей страны.

Принцип работы зернового комбайна прост. Основным рабочим инструментом является жатка. Она расположена впереди машины, через жатку скошенные колосья попадают в молотильный узел. Зерно очищается от грязи и отходов при помощи воздуха и решёток.

Кабина оператора расположена слева от молотилки. По анализу экспертов — это существенный недостаток конструкции. Оператор не может полностью контролировать шнек жатки.

За кабиной располагается бункер для зерна, а за ним двигатель. Зерновой комбайн работает на ременном приводе, то есть за движение всех узлов машины отвечают ремни.

Комбайн Нива СК-5

Колёса комбайна разного диаметра. За управление и поворот отвечают маленькие задние колёса. Передние колёса большого радиуса являются неуправляемыми. Соответственно для этой машины понадобятся шины разного радиуса.

Стоит отметить, что на зерновой комбайн советского образца, можно с успехом поставить шины от известных западных производителей.

Рассмотрим производительность зерноуборочных машин «Нива» на примере модели Ск-5.

Комбайн Нива СК 5

Технические характеристики этого комбайна более детально рассмотрим при помощи таблицы:

Габариты длина/ширина/высота

7607/3930/4100 мм

Вес комбайна

7400 кг

Производительность

5 кг/сек

Шнек жатки

5 м

Ёмкость бункера

3000 л

Двигатель

Дизельный, мощность 155 л. с

Объём топливного бака

300 л

Количество рабочих ножей

64 шт

Измельчитель соломы

двухрешётчатый

Наклонная камера

транспортёрная лента

https://youtu.be/SVKa_aBhAAM

Из приведённой таблицы можно сделать выводы, что зерновой комбайн Нива СК-5 очень компактная модель. Это позволяет ему уверенно себя чувствовать даже на небольших полях. Сложные границы поля и невысокие показатели урожайности тоже не являются ограничением для работы машины.

Высокую производительность обеспечивает наклонная камера, транспортёр которой минимизирует потери убранного зерна.

Измельчитель соломы обеспечивает чистоту намолоченного зерна.

Стоит отметить, что в соломотрясе имеется система, которая возвращает недомолоченную массу в повторную обработку.

Машина отличается большой манёвренностью и лёгкостью в управлении. Этому способствует не только мощный двигатель, но и гидравлический усилитель руля. Такая мобильность позволяет использовать комбайн СК 5 даже в самых экстремальных условиях.

В настоящее время можно приобрести комбайны «Нива» нового образца на гусеничном ходу. Это позволяет использовать технику на труднопроходимых грунтах и заболоченной почве.

За изменение рабочего положения жатки отвечает встроенная гидравлическая система. Кабина оператора оборудована по европейским стандартам. В ней имеется кондиционер и система обогрева. Кроме того, кабина надёжно защищена от пыли и шума.

Комбайн Нива СК-5М-1

Как и любая техника советского образца, зерновой комбайн Нива, очень редко выходит из строя. Даже в случае непредвиденной поломки, проблем с запчастями не возникает.

Большинство узлов по силам заменить оператору, без привлечения узких специалистов. Это позволяет производить ремонт в полевых условиях, сводя к минимуму вынужденный простой техники.

Но даже такая совершенная техника имеет недостатки конструкции. Это не портит общей положительной картины, но всё-таки доставляет неудобство в эксплуатации:

  1. Жатка. Вся система очень сложна в монтаже и требует дорогостоящего обслуживания.
  2. Ремни. Отвечают за работу всех основных систем, вследствие чего быстро изнашиваются и нуждаются в постоянной замене.

Но в целом комбайн СК 5 Нива довольно надёжная машина, рассчитанная на длительный срок эксплуатации.

Зерновой комбайн Нива СК-5М

Модель СК-5М-1, это модернизация комбайна предыдущей модели. Комбайн в основном предназначен для уборки зерновых культур. Если установить дополнительное оборудование, можно обрабатывать поля кукурузы, бобовых культур и сои. Комплектация техники осуществляется по желанию заказчика. Это может быть жатка, или подборочная платформа.

Комбайн Нива СК-5М-1

Технические характеристики Нивы СК-5М-1:

Габариты: длина/ширина/высота

10920/4130/3970 мм (длина указана с учётом жатки)

Вес с жаткой

8087 кг

Двигательчетырёхтактный, мощностью 155 л.с
Скорость работы ножей

904 среза в минуту

Объём зернового бункера

3 кубических метра

Объём топливного бака

300 л

Барабан длина/диаметр

1185/600 мм

Производительность

7000 кг/час

СК-5М-1 очень надёжный в эксплуатации зерновой комбайн. Производители учли все недоработки предыдущих моделей, как следствие, комбайн нового образца стал на порядок лучше.

Кабина оборудована анатомическим сиденьем повышенной комфортности. Встроенный кондиционер работает в двух режимах: охлаждение и вентилятор.

Комбайн Нива СК-5

Для звукоизоляции кабины используются только современные и высокотехнологичные материалы. Это обеспечивает более комфортные условия для работы оператора.

Учитывая опыт частой замены приводных ремней на зерновом комбайне СК-5, стали использоваться немецкие аналоги. Ремни, производимые в Германии, имеют больший запас прочности и соответственно реже нуждаются в замене.

Изменилась ширина заднего моста. Теперь она равна передней, что позволяет колёсам двигаться по одной колее. Это пошло на пользу управляемости машины. Кроме того, одна колея наносит меньше вреда окружающему ландшафту, что способствует увеличению сбора урожая.

Для мотовила теперь используются цельнометаллические трубы. В предыдущих моделях трубы были сварными, что снижало жёсткость конструкции.

У двигателя имеется большой запас мощности, что обеспечивает плавный ход даже на сложных и труднопроходимых участках.

Имеются у техники и недостатки. Замечены недоработки коробки передач. По отзывам операторов, машина плохо трогается с места на мягком грунте. Если зерновой бункер заполнен, стронуть комбайн с места является большой проблемой.

При перегонах комбайна наблюдаются обрывы жаток. Это относится в основном к десятиметровым конструкциям.

Стоит отметить, что производители постоянно следят за всеми недостатками своих сельскохозяйственных машин. Поэтому скорее всего, в ближайшем будущем эти минусы будут устранены.

технические характеристики и особенности уборки урожая

Зерноуборочный комбайн Нива СК-5 очень популярен, многих привлекает его простота и довольно высокая надежность в эксплуатации, а также сравнительно невысокие затраты.

Где применяют комбайн Нива СК-5?

Зерноуборочный комбайн СК-5 «Нива» предназначен для уборки зерновых. После переоборудования он справляется с уборкой кукурузы. Постановка на полугусеничный ход позволяет успешно убирать рис. Небольшие доработки жатки дают возможность выполнять уборку гречихи, сои и других крупяных культур.

Особенностью является сравнительно небольшие габаритные размеры и масса. СК-5 успешно эксплуатируется на больших площадях, в то же время из-за небольшого радиуса поворота его успешно используют на небольших полях.

Для многих фермеров этот комбайн подходит идеально.

Общий вид зерноуборочного комбайна СК-5 «Нива». Видны жатка, кабина, бункер и накопитель соломы

Основные преимущества данного комбайна:

  • небольшие габариты и масса позволяют применять на ограниченных территориях, а также на уклонах;
  • довольно высокая удельная производительность обеспеченная оптимальным соотношением транспортеров разного типа;
  • удачная конструкция соломотряса позволяет снизить потери зерна;
  • облегчено управление за счет использования гидроусилителей руля, а также подъема и опускания навесного оборудования;
  • автоматически выполняется сброс соломы накопителем;
  • оптимизирована конструкция кабины, где для водителя созданы довольно комфортные условия при пониженной вибрации и низком уровне шума.

Совет # 1. Для сохранения легкости управления комбайном нужна регулярная замена (в среднем каждые 20 дней в период уборки) масла в гидроприводе.

Комбайн СК-5 «Нива», вид сзади. Видны копнитель, транспортер-питатель зернового бункера, клиноременный вариатор и двигатель СМД-19К

Комбайн СК-5 «Нива» получил наибольшее распространение в европейской части России. В период СССР реализовывался в колхозы и совхозы Республик Кавказа и Средней Азии. Поэтому довольно большое количество комбайнов имеется на их территории. Читайте также статью:→“Комбайн Дон 1500 в фермерском хозяйстве”

Технические характеристики комбайна СК-5 «Нива»

Рассмотрим основные характеристики комбайна в таблице. Читайте также статью:→“Технические характеристики комбайна Енисей 1200”

Наименование показателей Единицы измерения Численные значения
Габаритные размеры комбайна:
длина мм 7607
ширина (без жатки) мм 3930
высота мм 4100
Масса кг 7400
Объем бункера для зерна л 3000
Скорость выгрузки зерна шнековым транспортером кг/с 40
Суммарная длина соломотряса м 3,6
Количество клавиш соломотряса шт. 4
Тип молотильного аппарата барабан
Максимальная ширина жатки м 5

Особенность конструкции – это наличие ведущих неповоротных передних колес, а также неведущих поворотных задних колес. Сельскохозяйственные агрегаты приводятся в действие клиноременными передачами, снабженными вариаторами.

Автоматически регулируется подача зерновой массы, обеспечивается оптимальное соотношение между поступательной скоростью и скоростью обмолота. Сбалансирована скорость вращения коленчатого вала привода соломотряса.

Общий вид дизеля Д-260. Видны блок на 6 цилиндров, рядный топливный насос, вентилятор системы охлаждения, пневматический компрессор, турбокомпрессор и стартер

В качестве силовой установки используются дизельные двигатели харьковского завода «Серп и молот» (серия СМД), а также Минского моторного завода (серия Д). В последние годы используется энергонасыщенный шестицилиндровый дизель Д-260 с турбонаддувом мощностью 155 л.с.  С эти двигателем выпускается новая модель комбайна СК-5 «Нива – Эффект».

Основная эксплуатация комбайна должна производиться не на максимальной мощности, а примерно 75…85 % от номинала. Поэтому рычаг управления регулятором топливного насоса высокого давления устанавливают не до конца, а на отрегулированные упоры. Только в случаях необходимости преодолеть повышенное сопротивление кратковременно его переводят в положение максимума.

Особенности уборки колосовых растений комбайном СК-5 «Нива»

При прямом комбайнировании уборка совмещается с обмолотом. Такой способ применяется в южных областях (Астраханская, Волгоградская, Саратовская, Ростовская и другие области юга России). Скашивание выполняется специальной косилкой, установленной на раме жатки. Читайте также статью:→“Убор зерна комбайном “Полесье””

Общий вид жатки с косилкой. Видно мотовило с приводом и косилка

Жатка не просто висит на раме комбайна. При скашивании зерновых она опирается на копирующие башмаки. Тогда высота среза по всей ширине остается постоянной. У башмаков разная высота от 50 до 180 мм. Используя специальные пружины, добиваются определенного усилия давления башмака на почву.

Совет # 2. Иногда возникает ситуация, когда скашивание нужно выполнять по рыхлому грунту или влажной почве. Перед башмаком набирается валик почвы, тормозящий перемещение вперед. В этом случае башмаки снимают, жатка висит на раме комбайна.

Особенности устройства жатки

Устройство жатки следующее:

  1. Мотовило приподнимает полегшие стебли. Оно вращается в эксцентриковом механизме привода. Такое сложное движение лучше приподнимает полегшие хлеба.
  2. Режущий аппарат – это пальцевый брус с одинарными пальцами. К ним приклепаны противорежущие пластины. Шарнирно-телескопическая передача приводит в движение нож.
  3. Шнековый транспортер смещает срезанную массу к центру.
  4. Пальцевый механизм, расположенный в центре направляет хлебную массу на наклонный транспортер.
  5. Наклонный транспортер осуществляет подачу зерновых на молотильно-сепарирующее устройство, размещенное внутри комбайна.
  6. Подборщик используется при раздельном комбайнировании, когда выполняется скашивание в валок, а через несколько дней подбор молотьба хлеба.

Типы жаток, используемых на комбайне СК-5 «Нива»

Комбайн СК-5 «Нива» оснащается разными типами жаток.

Тип жатки Ширина захвата Убираемые сельхозкультуры и вид уборки
ЖВН-6А 6 Пшеница, рожь, ячмень, овес при прямом комбайнировании
ЖШН-6 6 Пшеница, рожь, ячмень, овес при раздельном  комбайнировании, формирует валок, в котором колосья размещаются в верхней части
ЖНС-6-12 Пшеница, рожь, ячмень, овес при раздельном  комбайнировании, формирует валок, в котором колосья размещаются в верхней части. Один валок формируется с двух проходов комбайна
ЖВР-10 10 Скашивание изреженных хлебов
ЖРБ-4,2 4,2 Бобовые и крупяные культуры, семенники трав, полеглые стебли, зеленый горошек, гречиха.
ЖНУ-4 4 Бобовые культуры, рис, семенники трав, гречиха
ППК-4 4 Уборка кукурузы
КМС-4 4 Уборка кукурузы
Общий вид жатки ППК-4, используемой для уборки кукурузы. Видны специальные колосники, направляющие стебли кукурузы на наклонный транспортер

Возможные ошибки при скашивании зерновых:

  1. Неправильный подбор скорости вращения мотовила. В результате верхняя часть отбрасывается сильно вперед, что нарушает условия резания стеблей. Регулирование выполняют на ходу, внимательно наблюдая за ходом процесса уборки.
  2. Использование жаток ЖВН-6А или ЖШН-6 на разреженных хлебах. Получаемый валок имеет слишком малую удельную массу. Производительность на обмолоте крайне низкая.

Подборщик для жаток бывает двух типов: барабанный и полотенно-транспортерный подборщик.

Барабанный подборщик имеет барабан длиной 3 м. Пальцы барабана подают массу на шнек, а затем она перемещается на наклонный транспортер.

Полотенно-транспортерный подборщик – это резинометаллическое устройство, осуществляющее сбор и подачу массы  на транспортер наклонного типа. Наибольшее распространение получил полотенно-транспортерный подборщик.

При регулировке режима работы полотенно-транспортерного подборщика устанавливают скорость на 20-30 % выше линейной скорости движения комбайна.

Жатки зерноуборочных комбайнов отечественного производства взаимозаменяемые, поэтому поиск комплектующих можно производить не только для СК-5, а также и для других комбайнов, например, «Енисей – 1200».

Ошибка при регулировке скорости работы подборщика – это слишком высокая скорость по отношению к линейной скорости сельхозмашины (более 30 %). Это ведет к разрыву валков и выбиванию зерна раньше поступления на молотильно-сепарирующий аппарат.

Наклонный транспортер является неотъемлемым элементом жатки. Его планки перемещают хлебную массу по плоской поверхности корпуса, направляя ее в молотильно-сепарирующее устройство.

Особенности молотильно-сепарирующего аппарата комбайна СК-5 «Нива»

Производственный процесс обмолота хлебной массы довольно сложный. Нужно отделить солому от зерна. В специальных деках устроены отверстия, сквозь которые может провалиться зерно. Легкие частицы соломы, имея большие линейные размеры в эти отверстия не пройдут.

Окончательно зерно очищается на зерновых токах, где используют совсем другие машины.

Схема работы молотильно-сепарирующего устройства комбайна СК-5 «Нива». На рисунке показаны жатка в сборе с наклонным транспортером, молотильный барабан, битер, соломотряс, измельчающий барабан, шнек измельчителя, зерновой шнеком, бункер для накопления зерна и другие элементы

Процесс обмолота выполняется в определенной очередности отдельных процессов.

  1. Зерновая масса поступает на барабан, бичи выбивают зерно из колосьев.
  2. Оно проваливается вниз через отверстия в деке. Чтобы меньше повреждать зерна, предусмотрено нанесение удара по касательной.
  3. Далее зерно движется по стрястной доске, а потом по скатной доске попадает на зерновой шнек.
  4. Но на барабане не выделяются все зерна, имеющиеся в массе, поступившей на переработку. Поэтому она направляется на соломотряс.
  5. Соломотряс совершает сложное движение, имеющее вид эллипса.
  6. Зерновая масса распушается.
  7. Возникает возможность разделения тяжелых колосков и легкой соломы.
  8. Зерна протряхиваются и сквозь жалюзийные отверстия.
  9. Они падают на стрястную доску, а потом и на скатную доску.
  10. В дальнейшем и эта часть потока зерна поступает на шнековый транспортер зернового шнека.
  11. Солома измельчается на барабане.
  12. Вентилятором она перемещается за пределы комбайна в транспортное средство, идущее сзади.
  13. Зерно в бункере накапливается.
  14. Из бункера зерно шнеком отправляется в транспортное средство, которое может заполняться, как на месте, так и в движении.

При настройке регулируют скорости вращения барабан, битера, а также зазоров между барабаном и декой. Если объем хлебной массы небольшой, то зазоры уменьшают, а угловую скорость барабана снижают. Соответственно, при повышении объема проводят регулировки. Анализируют количество потерь зерна визуально. Эту работу выполняет обычно помощник водителя комбайна.

При забивании соломотряса возможна остановка. Сигнал об остановке подается на панель управления в кабине. Нужно уменьшать скорость движения комбайна.

На современных комбайнах часто отключают или полностью снимают копнитель. Солому в измельченном виде разбрасывают по полю. Агрономы полагают, что солома, перегнивая в почве, способствует сохранению плодородия.

Приобретение зерноуборочных комбайнов для фермерского хозяйства

Приобрести комбайн для фермерского хозяйства можно по рекомендациям знакомых. Но это далеко не все способы поиска. В современных средствах массовой информации имеются рубрикаторы, в которых обязательно имеется раздел, посвященный сельскохозяйственной технике. Именно там и следует начинать поиск информации о наличии нужного вида сельхозтехники для собственных нужд.

Интернет все более активно выступает в качестве площадки для поиска информации. В таблице, представленной ниже, показана эффективность разных СМИ по поиску и приобретению разных видов техники, в том числе и техники для села. Данные предоставлены МАСМИ в 2015 г.

Вид СМИ Просмотр информации населением, % Приобретение по рекламе, %
Газеты 3…4 2…4
Журналы 5…8 2…5
Интернет 1…1,5 0,5…0,8
Телевидение 5…9 3…5
Радио 0,5…1 0,3…0,4

Как видно из приведенной таблицы, активность населения сравнительно невысока. Интернет только набирает своих пользователей. Эффективнее всего оказывается телевидение.

Наличие мобильной связи позволяет связаться с продавцом в кратчайшие сроки. Если найдено объявление с интересующей информацией, то можно попросить снять небольшой фильм, который продемонстрирует работоспособность товара. Снять на смартфон небольшой ролик совсем несложно. Даже в сельской местности обязательно есть люди, способные оказать продавцу помощь в снятии ролика и отправке его покупателю.

Оцените качество статьи. Мы хотим стать лучше для вас:

Комбайн СК-5 Нива

Описание и характеристики, устройство и принцип работы. Все это мы рассмотрим в статье.

В данной статье мы с Вами рассмотрим комбайн для уборки зерна СК-5М Нива.

Описание. История

Его история началась еще во времена СССР в 1960 г., тогда завод «Ростсельмаш» выпустил марку комбайна СК-4. Этот вариант очень хорошо зарекомендовал себя на полях Советского Союза. Однако, «Ростсельмаш» спустя 10 лет решил выпустить на смену советскому комбайну более новую модель – СК-5. Вот она и прижилась среди фермеров до сегодняшнего дня. Отличительной чертой от первой модели является более комфортабельная и герметичная кабина, что непременно было оценено комбайнерами. На сегодня выпуск комбайна идет, как СК-5 «Нива Эффект».

Мало кто задумывается, почему комбайн имеет такое название. Но все очевидно. СК означает, что  Нива самоходный комбайн. А цифра 5 означает производительность, которая составляет 5 килограмм в секунду.

Принцип и устройство работы. Очистка зерна

Комбайн СК-5 является достаточно сложным механизмом, который включает в себя большое количество компонентов и узлов. Поэтому, принцип работу в двух словах не описать.

Зерновые колосья скашиваются при помощи жатки. После чего они поступают в молотилку. Чтобы это произошло, мотовило, в процессе вращения, наклоняет колос и режущий аппарат срезает его. А затем, колос попадет в суживающий шнек. После этого колосья идут в наклонную камеру. А далее, путь проходит через молотильно-сепарирующее устройство. Сокращенно его называют МСУ.

И это далеко не все. Приемный битер полученную колосовую массу транспортирует к барабану. Нередко в эту массу попадают камни. Поэтому, на комбайне предусмотрен камнеуловитель. Теперь путь колосьев пролегает через камеру камнеуловителя, после которой их уже ждут лопасти битера. Следующей остановкой после лопастей станет зазор, который расположен между декой и барабаном. В доске есть дырочки. А бичи барабана колосья. Но, чтобы этот процесс был менее травматичным, на поверхностях бичей расположены специальные насечки. Следовательно, процесс выбивания становится более скользящим. Зерно из обмолоченных колосьев высыпается посредством удара о поперечную планку. На этом этапе от колоса освобождается большая часть зерен. Но что-же делать с теми зернами, которые еще не преодолела планка? Конструкторы комбайна нашли выход! И путь недомолоченных колосьев ведет в соломотряс!  В соломотрясе зерно и солома распушиваются и идут к копнителю. Зерно и колоски с зерном тяжелее соломы, поэтому, они падают вниз и идут на доску очистки. А солома, которая нам уже не нужна, идет в копнитель.

Следующим этапом для зернового вороха станет стрясная доска. От нее он следует к пальчиковой решетке. Маленькие частицы идут вниз, а крупные – вверх. Через жалюзи верхнего решета проваливаются мелкие колоски и зерно. А крупным – предстоит испытание вентилятором, который выдует всю полову. Теперь зерно с колосьями находится на нижнем решете и перемещается назад. Им придется разделиться. Жалюзи будут приоткрыты всего на одну треть и пройти через которые смогут лишь зерна.  А недомолоченные колосья проедутся по скатной доске и упадут прямо в колосовой шнек. Зерно попадет в зерновой шнек. Теперь колосьям придется пройти в элеватор, после чего они отправятся в колосовой шнек. Потом путь проходит через отбойный битер с барабаном для домолота. Зерно поступит в бункер. Солома – уменьшается в размерах вдвое и выгружается, путем нажатия на педаль.  Обращаем Вашем внимание, что комбайн может быть оборудован измельчителем. Его ставят вместо копнителя.

Устройство комбайна достаточно сложное, поэтому разберем его механизмы и системы по отдельности.

Для начала, давайте ознакомимся с его техническими характеристиками, в которых Вы найдете ответы на многие вопросы, как: сколько весит комбайн, мощность, габариты, размеры, обороты барабана и многое другое.

Технические характеристики СК-5 Нива:

 

Гидравлика. Рулевое управление

Гидравлическую систему можно разделить на два пункта: основная и рулевая.  В контексте рулевой системы управляемыми являются задние колеса. Следует отметить, что на Ниве рулевое управление является гидрообъемным. Это значит, что между рулевыми колесами и управляющими колесами нет механической связи, поскольку они соединяются между собой гидравликой.  Составляющими элементами являются: шестеренный насос НШ 10, распред, гидробак, цилиндр и насос-дозатор.

Рабочий тормозной цилиндр передает усилия в гидравлическое давление, которые водитель прикладывает к педали при нажатии тормоза.

Преимущества гидравлики в рулевом управлении, по сравнению с механикой, неоспоримы:

— меньше узлов;

— легче проводить поворот колес;

— меньший размер люфта при работающем гидроусилителе;

— требуется значительно меньше времени на регулировки и тех. обслуживание;

— более удобное размещение рулевого колеса и элементов под кабиной водителя.

Если рассмотреть основную, то в нее входит: шестеренный насос  (НШ 32), предохранительный клапан, распределитель, ГЦ вариатора, ГЦ поднятия мотовила и жатки. А также, система очищения воздуха, процесс открывания копнителя и вибратор бункера.

Для нормальной работы гидравлики следует следить за тем, чтобы масло было чистым. Поэтому, Вам обязательно пригодится фильтр очистки масла.

Все эти элементы Вы можете приобрести в нашем магазине.

Ниже представлена схема гидравлической системы:

Жатка

Одним из важнейших элементов комбайна является жатка. Главной ее задачей является срезание колосьев и перемещение их в молотилку. Также, к ней можно присоединить подборщик. Его задачей является подбор срезанных колосьев из валков. Размер захвата может быть разным. Это достаточно сложная конструкция, поэтому, можно рассмотреть ее элементы следующим образом:

Корпус с башмаками. К этой части крепятся все сопутствующие органы жатки. Его крепят на наклонную камеру. Благодаря натяжению пружины можно отрегулировать давление на почву. А с помощью башмака возможно менять высоту среза колосьев.

Мотовило. Благодаря этому элементу стебли удерживаются на момент срезания, после чего, благодаря нему они отправляются в шнек.

Режущий аппарат. Здесь название говорит само за себя. Данный элемент срезает колосья.

Шнек. Благодаря ему скошенная масса проходит к транспортеру. На внешний вид он представляет собой элемент цилиндрической формы, внутри которого расположены ленты по спирали. По ним масса сужается и перемещается.

 

Транспортер. Перемещает срезанную массу колосьев от шнека в молотилку.

Подборщик. Собирает срезанные колосья и транспортирует их на платформу жатки. Но, для того, чтобы им воспользоваться, сначала следует снять мотовило.

Двигатель

Одним из важнейших элементов любой техники является двигатель. Этот вид техники оборудован двигателем СМД, имеющий мощность от 100 до 120 л.с. Двигатели СМД-19К и СМД-20К оборудованы также интеркулером. Последние версии комбайна оборудуют мотором Д-260.1 с теплообменником и турбонаддувом. Однако, у большинства комбайнов Нива стоят 4-х цилиндровые СМД двигателя, поэтому, большинство запчастей представлены именно на него. Приобрести необходимые запчасти и комплектующие можно в нашем магазине.

Ниже представлены фото двигателей.

 

Ходовая часть подробнее

В ходовую входит мост из ведущих колес и управляемых.

Давайте рассмотрим ведущий мост более детально. Он состоит из:

Коробка передач. В нее идет вал и шестеренки. У нее есть три передачи, а также, задний ход. После включения необходимой передачи шестерни блокируются специальным механизмом.

Муфта сцепления. В нее идет ведомый и выжимной диск, а также, пружины. Ставят ее на приемный шкив коробки. После того, как сцепление выключается, муфта выполняет давление на рычаги, впоследствии, освобождается ведомый диск. Вращательные движения передаются на коробку передач.

Дифференциал. Это целый узел, в который входят шестерни, чашечки, сателлиты и крестовины. Основной его задачей является распределение вращения между двумя сторонами, чтобы колеса могли крутиться с разной скоростью.  

Редуктора бортовые.

Колеса.

      

Благодаря переднему мосту комбайн может ездить по неровным поверхностям, на рыхлых и влажных почвах и сложным рельефам.

Теперь рассмотрим, что-же входит в мост управляемых колес:

Жесткая балка.

— Поворотные кулаки.

— Трапеция, гидроцилиндр.

— Колеса задние. Они имеют меньший размер, чем передние.

     

Благодаря заднему мосту комбайн сможет более точно маневрировать.

Вариатор

Одним из важных элементов комбайна является вариатор. Вращение от шкива мотора на шкив коробки перемены передач переходит через клиномерную передачу. Вот для чего он нужен. Он позволяет изменить передаточное число на ремне. Благодаря гидроцилиндру диск блока ходит по оси. Когда диск идет в левую или правую сторону, меняется и ширина ручья. Когда ремень находится глубже, диаметр становится меньше, и наоборот. Водитель может им управлять из салона. Для этого на гидрораспределителе есть специальный рычаг. Если золотник переключить вперед – то будет максимальная скорость. Для того, чтобы добиться минимальной скорости следует переключить ручку золотника на гидрораспределителе назад.

Электрооборудование

Электрооборудование комбайна является достаточно важным для его нормальной работы. Они  позволяют запустить мотор, освещение и контролируют сигнализацию. Поэтому, электрика состоит из целого ряда элементов. Рассмотрим детальнее:

Аккумуляторные батареи и генератор. Они являются источником тока.

Стартер СТ-100. Имеет напряжение 24 В и мощность 8,2 кВт. Устройство достаточно тяжелое – 26 кг! Данная модель изготавливалась во времена СССР, поэтому в настоящее время можно приобрести только реставрацию. Стартер является пусковым устройством для дизельного двигателя. Внутри корпуса расположены электромагниты и обмотка и якорь.

  

Фара ФГ-305. Это передние фары. Благодаря им происходит освещение дороги как ближним светом, так и дальним.

Фара ФГ-304. Это задние фары. Они пригодятся для освещения при погрузочно-разгрузочных работах.

Габаритные фонари. Расположены спереди и сзади комбайна. Подают сигналы поворота и стоп.

Сигнальные устройства. Предназначены для контроля уровня зерна. Местом установки таких сигналов является бункер, шнек, соломотряс и копнитель.

Комбайн «Нива» имеет и другие важные элементы.

Радиатор

Радиатор является элементом системы охлаждения. Для двигателя СМД применяется радиатор водяного охлаждения. В него входит сердцевина, бачки, патрубки и прокладки. На внешний вид похож на решетку. Именно сердцевина радиатора понижает температуру жидкости.

   

Ремни

Сложно представить себе комбайн без ремней. Эти незначительные на первый взгляд элементы играют очень большую роль, поскольку многие узлы зависят от ременной передачи. Важно, чтобы резина была качественной для большего срока службы.

Ниже расположен чертеж с ремнями, звездочками и цепями.

Сегмент

Одной из наиболее распространенных деталей, которую покупают на комбайн, является сегмент на жатку. Он выпускается под каталожным номером Н.066.02. На внешний вид сегмент похож на треугольник. На двух сторонах которого расположены зубья, а третья нижняя сторона плоская. И с нижней стороны есть два отверстия для крепежа на косу. Для того, чтобы полностью оборудовать режущих аппарат, Вам понадобится 52 сегмента. Фото сегмента Вы можете смотреть ниже.

Измельчитель

Измельчитель-разбрасыватель является достаточно важным оборудованием комбайна, поскольку в условиях нашего климата очень важным вопросом является задержка влаги в почве и ее удобрение. Измельченная солома, разбросанная по полю, позволит задержать влагу. А для того, чтобы она быстрее разложилась, ее и следует измельчать.

Подшипники

Одним из незаметных элементов комбайна являются подшипники. Если Вы думали, что их там не много, рекомендуем ознакомиться с таблицей ниже.

Если Вы фермер и решили сделать ремонт своими руками, а также, всякого рода переделки, очень важно успеть до начала уборки в поле. Модернизация является важным элементом для комфортной эксплуатации. Вы уже знаете, как выглядит комбайн изнутри и готовы провести тюнинг? Тогда закажите у нас необходимые для Вас запчасти! Наши цены Вас приятно удивят, а индивидуальный подход к каждому клиенту сделает наше сотрудничество максимально приятным. Звоните!

Нива Эффект СК-5 / Зерноуборочные комбайны / Սպեցմաշ

Характеристика Ед. изм. Значение
Жатка
Ширина захвата жатки м 4,1/5,0
Предварительные установки высоты среза мм 50/100/130/180
Скорость срезов ножа срезов/мин 904
Частота вращения мотовила об/мин 16-42
Обмолот
Диаметр барабана мм 600
Длина барабана мм 1185
Частота вращения барабана, мin об/мин 743
Частота вращения барабана, мax об/мин 1260
Угол охвата подбарабанья град. 146
Общая площадь подбарабанья кв. м 0,93
Сепарация
Тип соломотряса 4 клавишный
Длина соломотряса м 3,618
Площадь сепарации соломотряса кв. м 4,34
Очистка
Общая площадь решет кв. м 2,42
Тип вентилятора очистки пятилопастной
Частота вращения вентилятора очистки об/мин 432-723
Двигатель
Тип двигателя 4-х тактный с турбонаддувом
Модель двигателя Д-260.1
Производитель двигателя Минский моторный завод
Мощность двигателя кВт 114
Мощность двигателя л.с. 155
Удельный расход топлива, номинальный г/л.с. ч 162
Емкость топливного бака л 300
Зерновой бункер
Вместимость бункера зерна куб. м 3
Высота выгрузки мм 2600
Скорость разгрузки бункера л/сек не более 180 сек
Габаритные размеры и масса
Длина с жаткой в транспортном положении мм 10920 
Ширина в транспортном положении мм 4130
Высота в транспортном положении мм 3970
Масса без жатки/ с жаткой кг 6637/8087 

Комбайны Нива СК-5 и СК-4 — технические характеристики, видео

Отечественные комбайны марки Нива успешно сочетают в себе прекрасно сбалансированную конструкцию, правильный подбор комплектующих, высокую производительность и отличную маневренность на участке. Сельхозмашины этого бренда просты в применении и ремонте, они не нуждаются в специальном обслуживании, однако главная особенность, за которую технику Нива так любят отечественные аграрии – это ее крайне низкая стоимость.

Комбайн Нива СК-5 – особенности и преимущества

Популярный зерноуборочный комбайн нива СК-5 относится к категории самоходных сельхозмашин повышенной производительности. Модель зарекомендовала себя в качестве надежного и довольно маневренного помощника при сборке зерновых на средних и крупных аграрных угодьях.

Конструкция комбайна Нива в этой комплектации состоит из 5 основных элементов: двигателя, ходовой части, молотилки, жатки и копнителя. Помимо этого в комплектацию агрегата входит мощная гидравлическая система, органы управления и сигнализации, а также механизмы привода.

Устройство комбайна Нива СК-5 может дополняться жатками разных размеров. В базовой комплектация сельхозмашина оборудована жаткой ЖКН-6, ширина рабочего захвата которой составляет 6 м. В качестве дополнения в конструкции предусмотрены однобарабанная молотилка, битер, дека, 4-клавишный соломотряс и 2-вентиляторная очистная система.

Посредством гидравлической системы комбайна СК-5 осуществляется загрузка бункера, управление поворотами, закрытие дверец копнителя и очистка радиаторного фильтра. Такое конструктивное решение делает эксплуатацию зерноуборочного комбайна Нива более удобной, и позволяет оператору полностью контролировать процесс сбора урожая.

Технические характеристики комбайна включают:

  • мощность – 155 л. с.;
  • емкость топливного резервуара – 300 л;
  • объем заборного бункера – 3000 л;
  • рабочая ширина стандартной жатки – 6 м;
  • масса – 7,4 т.

МодельСК-5 от компании Нива оснащена просторной комфортабельной и полностью герметичной кабиной, изготовленной с применением высококачественных звукоизолирующих материалов, Большой угол обзора предоставляет оператору возможность тщательно следить за процессом уборки зерновых культур.

В наши дни зерноуборочный комбайн Нива СК-5 активно используется для сбора наиболее распространенных сельскохозяйственных культур. При необходимости его можно активно эксплуатировать в целях сбора кукурузы, сои и других бобовых культур. О практических возможностях модели СК-5 более детально расскажет видео.

В числе основных преимуществ комбайна Нива СК-5 эксперты выделяют хорошо продуманную конструкцию, богатую комплектацию и высокую выносливость. Благодаря этому отечественная модель СК-5 может достойно конкурировать с сельхозмашинами всемирно известных брендов.

Комбайн Нива СК-4 – описание и возможности

Зерноуборочный комбайн СК-4 представляет собой эффективную высокопроизводительную сельхозмашину общего назначения. Агрегат используется для интенсивного для покоса стеблей выращенных растений с одновременной сепарацией собираемого зерна. Предусмотренный в конструкции комбайна измельчитель предназначен для быстрой нарезки собранных стеблей с целью их дальнейшего использования при мульчировании выращиваемых растений.

В комплектацию комбайна СК-4 входит надежный тракторный двигатель СМД-14, которым также часто оборудуется комбайн Енисей. Этот 4-цилиндровый дизельный мотор отличается высочайшей надежностью, экономичностью и простотой в самостоятельном обслуживании. Свободный доступ к расходным деталям позволяет быстро заменить изношенные запчасти ДВС без его полной разборки. Для запуска основного двигателя в комплектации зерноуборочного комбайна СК-4 предусмотрен специальный пусковой мотор.

Для передачи вращательного усилия мотора на мосты агрегата в конструкции сельхозмашины предусмотрена износостойкая трансмиссия с механической КПП. Рулевое управление модели СК-4 осуществляется посредством валов червячного механизма с коническими шестернями. С целью облегченного управления колесами сельхозмашина снабжена дополнительным контуром гидроусилителя.

Жатка этого зерноуборочного комбайна оборудована режущим механизмом, разделителем, шнековым механизмом и эксцентриковым мотовилом. Благодаря возможности регулировки высоты башмаков, оператор модели СК-4 может менять высоту срезания стеблей в диапазонах 10–18 см. Для управления жаткой по обе ее стороны установлены гидравлические цилиндры.

В число основных преимуществ зерноуборочного комбайна СК-4 входят сравнительно небольшие размеры малый вес. Это дает возможность эксплуатировать модель на небольших по площади участках. Второй важный плюс сельхозмашины – это малые потери собираемого зерна. Третье достоинство агрегата – это более качественная очистка зерновой массы с возвратом не прошедшего очистку зерна обратно в  соломотряс.

Параметры зерноуборочного комбайна СК-4 включают:

  • мощность – 75 л. с.;
  • емкость топливного резервуара – 140 л;
  • объем заборного бункера – 1800 л;
  • рабочая ширина стандартной жатки – 3,2 м;
  • масса – 6,28 т.

В базовую комплектацию зерноуборочной машины СК-4 входит комфортабельная кабина, оборудованная органами управления, удобным водительским сиденьем, системами отопления и вентиляции, а также удобным сиденьем. Данные о состоянии и исправности основных рабочих механизмов комбайна выведены на информативную приборную панель.

Существенным недостатком зерноуборочного комбайна СК-4 эксперты считают довольно быстрый износ приводных клиновых ремней. Тем не менее, производитель предусмотрел свободный доступ к этим элементам, благодаря чему с их заменой не возникнет особых проблем. Еще один минус комбайна СК-4 – это необходимость в регулярном сервисном обслуживании системы подключения жатки.

В целом зерноуборочный комбайн СК-4 зарекомендовал себя в качестве надежного помощника на небольших и средних по площади участках. Агрегат успешно справляется с интенсивной работой под высокими нагрузками без значительного увеличения количества потребляемого топлива.

LADA Niva Legend 3 дв. – Технические характеристики – Официальный сайт LADA

  • Кузов
  • Колесная формула / ведущие колеса

  • Расположение двигателя

  • Тип кузова / количество дверей

  • Количество мест

  • Длина / ширина / высота, мм

  • База, мм

  • Колея передних / задних колес, мм

  • Дорожный просвет, мм

  • Объем багажного отделения в пассажирском / грузовом…

  • Двигатель
  • Код двигателя

  • Тип двигателя

  • Система питания

  • Количество, расположение цилиндров

  • Рабочий объем, куб. см

  • Максимальная мощность, кВт (л.с.) / об. мин.

  • Максимальный крутящий момент, Нм / об. мин.

  • Рекомендуемое топливо

  • Объем топливного бака, л

  • Динамические характеристики
  • Максимальная скорость, км/ч

  • Время разгона 0-100 км/ч, с

  • Расход топлива
  • Городской цикл, л/100 км

  • Загородный цикл, л/100 км

  • Смешанный цикл, л/100 км

  • Масса
  • Снаряженная масса, кг

  • Технически допустимая максимальная масса, кг

  • Максимальная масса прицепа без тормозной системы /…

  • Трансмиссия
  • Тип трансмиссии

  • Передаточное число главной передачи

  • Подвеска
  • Передняя

  • Задняя

  • Шины
  • Размерность

  • СК-5 Нива (комбайн) — это… Что такое СК-5 Нива (комбайн)?

    Комбайн СК-5 «Нива»

    СК-5 «Нива» — марка самоходного зерноуборочного комбайна, производимого в СССР заводом «Ростсельмаш» c 1970-го года, и производимого там же в настоящее время под маркой «Нива-Эффект»[1][2].

    Обозначение СК-5 — Самоходный Комбайн производительностью 5 кг/с.

    Комбайн СК-5 «Нива» является самым распространенным зерноуборочным комбайном в СССР и, своего рода, «визитной карточкой» отечественного сельхозмашиностроения.

    Комбайн является глубокой модернизацией комбайна СК-4, который производился в 1960-х годах. В настоящее время у комбайна появилась новая, более комфортная кабина с установленным кондиционером. Изменился и цвет комбайна: вместо традиционного красного используется зелёный. При производстве комбайна пришлось отказаться от услуг некоторых поставщиков, теперь на нём стоят импортные ремни и гидравлика.

    Технические особенности

    Комбайн СК-5 «Нива» выполнен по классической схеме с несущей молотилкой, навесной жаткой и навесным копнителем.

    • Жатка ЖКН-6 — ширина захвата 6 м[3].
    • Молотилка имеет один бильный барабан диаметром 600 мм, деку с углом охвата 128 градусов, отбойный битер, соломотряс с четырьмя клавишами, двухрешетчатую очистку с вентилятором, копнитель, снабженный соломонабивателем [4].
    • Двигатель — дизельный СМД-17К (СМД-18К) мощностью 100 л.с.или СМД-19К (СМД-20К)мощностью 120 л.с., оборудованный промежуточным охлаждением наддуваемого воздуха — интеркулером.
    • Привод агрегатов — клиноременный. Скорость вращения мотовила жатки, барабана и вентилятора регулируется с помощью вариаторов.
    • Ходовая часть колесного типа, передние колеса ведущие неуправляемые, задние колеса — неведущие управляемые.
    • Гидравлическое оборудование обеспечивает подъем-опускание жатки, подъем-опускание мотовила, регулирование скорости вращения мотовила, закрытие створок копнителя, управление вариатором скорости движения, очистку фильтра радиатора двигателя, виброразгрузку бункера, управление поворотом.
    • Автоматизация. Комбайн имеет следующие устройства автоматического регулирования: автоматический регулятор двигателя, поддерживающий постоянную частоту вращения коленчатого вала при изменении нагрузки на двигатель, автоматический регулятор загрузки молотилки, обеспечивающий постоянство поступления в молотилку скошенной массы за счет управления скоростью движения комбайна, автомат разгрузки копнителя — обеспечивающий автоматическое открытие створок копнителя при его заполнении и закрытие створок после полного опорожнения.

    Также устанавливались двигатели СМД-21

    Примечания

      Зерноуборочные комбайны СССР
    Самоходные

    Сталинец-4 • СК-3 • СК-4 • СКД-5 «Сибиряк» • СК-5 «Нива» • СК-6 «Колос» • СК-6 «Сибиряк» • Енисей-1200 • Дон-1200 • Дон-1500 • СК-10 «Ротор»

    Навесные НК-4
    Прицепные
    См. также Зерноуборочные комбайны России и стран СНГ

    Лада Нива 1.6 Технические характеристики и габариты

    Лада Нива 1.6 Технические характеристики двигателя

    Тип двигателя — Количество цилиндров: Рядный 4
    Код двигателя:
    Тип топлива : Бензин
    Топливная система : Карбюратор
    Регулировка двигателя: Продольный
    Объем двигателя — Рабочий объем — Объем двигателя: 1568 см3 или 95.7 у.е.
    Диаметр цилиндра x ход поршня: 79 x 80 мм
    3,11 x 3,15 дюйма
    Количество клапанов: 8 клапанов
    Стремление: N / A
    Коэффициент сжатия : 8,5
    Максимальная мощность — Выход — Мощность: 76 л.с. или 75 л.с. или 56 кВт при 5400 об / мин
    Максимальный крутящий момент: 118 Нм или 87 фунтов.фут при 3200 об / мин
    Ведущие колеса — Тяга — Трансмиссия: Полный привод
    Коробка передач Коробка передач — Количество скоростей:

    Лада Нива 1.6 Расход топлива (экономия), выбросы и пробег

    Расход топлива — Экономия — Открытая дорога: 10.4 л / 100 км
    27 миль на галлон UK / 23 миль на галлон США
    Расход топлива — Экономия — Город: 13,7 л / 100 км
    21 миль на галлон UK / 17 миль на галлон США
    Емкость топливного бака : 45 л
    9,9 галлона Великобритании
    11,9 галлона США
    Выбросы CO2: — г / км (Lada)

    Лада Нива 1.7i Технические характеристики и размеры

    Лада Нива 1.7i Производительность

    Максимальная скорость : 137 км / ч или 85 миль / ч
    Разгон от 0 до 100 км / ч (от 0 до 62 миль / ч): 19.0 с

    Лада Нива 1.7i Габаритные размеры, аэродинамика и вес

    Num. дверей: 3
    Колесная база: 220 см или 86.61 дюймов
    Длина : 374 см или 147,24 дюйма
    Ширина : 168 см или же 66,14 дюйма
    Высота : 164 см или же 64,57 дюйма
    Коэффициент аэродинамического сопротивления — Сх:
    Передние тормоза — Размеры дисков: Диски (- мм)
    Задние тормоза — Размеры Dics: Барабаны (- мм)
    Передние шины — Размеры дисков: 175/70 R16
    Задние шины — Размеры дисков: 175/70 R16
    Снаряженная масса: 1210 кг ИЛИ ЖЕ 2668 фунтов
    Соотношение массы и выходной мощности: 15.1 кг / л.
    Объем багажника / багажника: 300-1150 л
    Передняя подвеска: Независимая, McPherson, пружины винтовые, стабилизатор поперечной устойчивости
    Задняя подвеска : Ось De Dion, винтовые пружины

    Относительное воздействие множества факторов стресса человека в устьях и прибрежных водах в переходной зоне Северное море – Балтийское море

    Основные моменты

    Относительные воздействия нескольких факторов стресса человека были изучены в Северном море / Балтийском море.

    Наибольшее количество стрессоров на всей исследуемой территории — это питательные вещества и климатические аномалии.

    Питательные вещества и физические модификации оказывают более сильное воздействие на системы фьордов / устьев рек.

    Рыболовство, загрязняющие вещества и шум оказывают более сильное воздействие в прибрежных водах.

    Результаты предоставляют основанную на фактах информацию в поддержку экосистемного управления.

    Abstract

    Цели этого исследования: 1) составить карту потенциальных кумулятивных воздействий множественной деятельности человека и факторов стресса на экосистемы в переходной зоне между Северным морем и Балтийским морем для датских вод 2) проанализировать различия во вкладе стрессорных факторов между Рамочной директивой Европейского Союза по морской стратегии (MSFD, прибрежные воды) и Рамочной директивой по водным ресурсам (WFD, прибрежные воды), и 3) для оценки локальной относительной важности стрессорных факторов для 14 районов вдоль градиента суша-море , от внутренних фьордов или прибрежных районов до морских вод.Картирование кумулятивных воздействий основано на 35 наборах данных, описывающих широкий спектр факторов стресса человека и 47 компонентов экосистем, от фитопланктона над бентосными сообществами до рыб, морских птиц и морских млекопитающих, которые мы объединили с помощью широко используемой пространственной модели воздействия человека. Ранжирование стрессорных воздействий для всей исследуемой территории показало, что пятью основными стрессорными факторами являются: «Питательные вещества», «Климатические аномалии», «Некоренные виды», «Шум» и «Загрязняющие вещества». Исследования градиента показали, что некоторые стрессоры (например,грамм. «Питательные вещества», «Судоходство» и «Физическая модификация») оказывают относительно более сильное воздействие на системы фьордов / устьев, в то время как другие (например, «Рыболовство», «Загрязняющие вещества» и «Шум») оказывают относительно большее воздействие в открытых водах. Помимо составления карт кумулятивного антропогенного воздействия, мы обсуждаем, как карты можно использовать в качестве аналитического инструмента для информирования об экосистемном управлении и морском пространственном планировании, используя в качестве примеров MSFD и WFD.

    Ключевые слова

    Стрессоры

    Экосистемы

    Кумулятивные воздействия

    Градиенты давления

    Экосистемное управление

    Морское пространственное планирование

    Рекомендуемые статьиЦитирующие статьи (0)

    Просмотр аннотации

    © 2019 Автор (ы).Опубликовано Elsevier B.V.

    Рекомендуемые статьи

    Цитирующие статьи

    tlhaloso e, tobileng le ulasan pelanggan

    «НИВА СК 5» — ке ху е ка бэнг тшумо еа боенжиньер ле тсе рууоанг. Sena lab diske ee haholo e hlahile lilemo tse fetang tse 40 tse fetileng. Ka nako eo e ne e le ea mohlala ka ho fetisisa ratoa, массово sebediswa masimong в СССР. Компания «Ростсельмаш» нил а цоела пеле хо локолла фетолело ена, чувела хоале ке себъялебяле ле тхкнолоджи и фахаменг трест.Mechine e ncha na babatsehang ya data botekgeniki le khona ho hlōlisana le tsebahalang аналоги tsoang linaheng tse ling.

    E le busa, a sebelisa hona joale lihoai li tsena mechine le libakeng tse nyenyane bakeng sa lijalo. lefapha la sena, moo ho sebelisa theknoloji ea phahameng ha se chelete e ngata, ‘me hoo e ka bang maemong’ ohle — tse sa lokelang. Котуланг «Нива СК 5» ке ху е батланг е незаменимый libakeng tse nyenyane, ka lebaka la ho se ho hlokahala mokhoa ona ha e fela selemo le selemo.

    Pale ea

    Semela «Rostselmash», tsejoa ho pholletsa naha le libakeng tse hōle le meeli ea eona, e ile a qala ho hlahisa temo mechine qalong ea tse lekholo tse fetileng. Ка конвейер теохела ликопи це пеле.

    Kopana bakotuli «Field edy 5» a hlaha ka 1973. ea mohlala Sena se tla sebeletsa e le motheo bakeng sa ppo ea ho eketsehileng mechine e khethehileng haholo, ho etsa mohlala, tse kang:

    • diyuniti tsa matsoapong, boholo ba eo eo ea fihla ho likhato tse 30;
    • рисоуборочные бакотули, ба ба бах.

    Nakong e tlang, ea mohlala ea bohlano ho feta hang ntlafatswa. ‘Marakeng kajeno mochine o bitsoa «Tšimo-e le hantle».

    ya data botekgeniki

    Litlhaku ka sehlooho decrypted ka «ho intša propelled kopana,» ‘me ka lipuo palo ka tshebetso hae, tabeng ena — e 5 lik’hilograma / set lao. Ba bang kopana litšobotsi tse «Field edy 5»:

    • Литеканьо: болеле — 7607 лимилимитхара; бопхара — 3930 лимилимитхара; бофахамо ба — 4100 лимилимитхара.
    • Масса — 7,4 м.
    • Lebelo вращающийся tsa mochine pola emeloa ka mokgwa wa moqomo ke 2900 тенн / метс.
    • Bunker bokgoni — dilitha tse 3000.
    • Lehare le 64 e thehiloe.
    • Mokotuli bophara — limithara tse 5.

    матла и димела

    Moreki ke dienjini tse hlano tse sa tšoaneng, e leng e ka hlomelloa le lab «Field edy 5»:

    • RMA le RMA-17K-18K eo bokgoni ke a etsang dilitara tse 100. e.
    • СМД-19К; СМД-20К; СМД-21К, длина и длина 120 мм.

    dikai tsohle tse hlano — 4-сетороуку, 4-силиндара, ка-лайн морало, себецса хо туки диселе. 120-сильный наддув tlhahiso fumaneha. Pele phallo ho toba turbine le, moea o ka likhoka folisoa. Sena se nolofalletsa hore o ile sa qetella se eketsa matla a. likoloi morao-rao «Niva-e le hantle» ba a hlomelloa le 155-matla «pelo» le ho tšoaea D-260. Sena se noang enjene mafura — tlase. phepelo e khōlō ea moment etsa bonnete ba tsitsitseng le e ka tšeptjoang tshebetso esita le tlas’a meroalo e boima.

    phetiso

    версия kaofela ha li kopana hlomelloa le V-lebanta drive. Sena se bontša hore ntlha ea matla unit trust PPC ka theko e tšoaetsanoang ka ka ho sa V-lebanta phetiso, seo ho thoeng ke вариатор. Ena e se e ntlafetse ka monyetla oa ho lokisa le kotulang, «СК-5 Нива».

    CVT и трансмиссия, сделанная в одночасье с трансмиссией каро-каролелано. Tsela sebetsa e etsoa ka lebaka la ho осевое смещение ea unit trust khanna elements. Ho itšetlehile ka boemo ba disk, e le bophara ba le molapo ho fapana, ho itšetlehile ka parameterhara ena fapana bokella radius lebanta.

    Laoloa ho tloha terakeng. lebelo lebetsoeng ле е бэха, ле ха е се е бе хо «хутлела» — — В boemo fetisisa telele e mohele slide e fokolang haholo.

    Tools le mechine

    Poone «Field edy 5» e reretsoe ho seha le lipalangoang tse ling tsa boima ea lijo-thollo bakeng sa sebetsa ka ho eketsehileng ka thresher ka. Ho phaella moo, ho ka ho, установленный вене sebediswa bakeng sa tlhopho ya pele с фаской bakoa, e ba ‘nile ba, сложенный ка валки. platform boholo ‘na tsa fapana, ho itšetlehile ka maikemisetso, empa sebopeho sa ntse ho le joalo, le kenyelletsa ditokiseletso:

    • kenapa le lieta e khethehileng;
    • толокинг;
    • seha sesebediswa;
    • nsete;
    • конвейер phaphametseng mofuta;
    • нка-уп.

    seriti

    Profesionalce le boiphihlelo a pharaletseng a le mechine bakeng sa kotulo, hoo e ka bang ba ntsoe-leng pheha khang ea hore Molemo o ka sehloohong oa ho ea ea kopana — e hoa lhoo lee e batlang e tlaase. Thepa fapane sebopeho e bonolo le tlhokomelo e bonolo. Likarolo Запасной бак котуланг «Нива СК 5» ка рекоа нтле матхата леха и ле эфе, ха е теко ка теко и тлаасе. Joalo mochine — e lokela ho etsa khetho e babatsehang bakeng sa ho sebelisoa ea hona joale maemo a klimate a ea naha, le primers itseng itseng libakeng motho.

    mefokolo

    Khahlanong le semelo sa litšoaneleho tsohle tse ntle, ho na le go tlhoka mesola, eo haholo di raraanyang go tshebediso ya Combine unit trust. Недостаток ka sehloohong — e le ‘mele oa ho sebetsa ba вариатор ena. Lebanta drive ha a lumelle ho palama boreleli fatše batlang e le bonolo, le Hopper e tletseng. tšepahala khethehileng ke ke ithorise ba le tsamaiso kamano platform thepa.

    Ka ba bang kaofela — mochine o motle ho lihoai bao ba batla ho reka theko e tlaase, empa ka nako e le nngwe проверенный мохоа ле tshebetso bonolo.

    dikai morao-rao le ho ntlafatsa bona

    Ka mor’a letoto la upgrade le lintlafatso «Нива СК 5» амохетсе литиисо це нча фторкаучуковый хо эна ле рабара е киленг еа ба банг хо фета мохлоди ньеньяне. Ho tšepahala ha tsamaiso haeteroliki ho fana ka oli e hloekileng ka lebaka la ho переходы, thata hore ho thibela moea ho tswa ho ka hare. Оли phetoho ne ho hlokahala hore ho phethahatsoa mong le e mong lihora tse 50. Ka mor’a hore модернизации le ntlafatso ea bophelo ba selogetsi e eketsehile ho lihora tse 240.

    Ка копаньян цохле морао-рао хо цва хо хампани «Ростсельмаш» себедисва мабанта матлафацоа энцоенг Джеремане. Ho tšepahala ha likarolo tsena e bile ‘maloa tsa liteko. Хо ка этсахала хо экеца нако хо себеця я вариатор, каху энценг е экетсеха еа бокгони ба хо мехин котуло.

    хо фуманеха

    ‘Маракенг котуланг каджено «Нива СК 5» хо нкоа ка банг хето ка теко е тлаасе ка хо фетисиса хар’а эохле ромелва. litšenyehelo fapana ho 160 tse likete tse li-ruble (bakeng sa chelete u ka fumana mochine hore tla ba le tseleng, empa o tla hloka ho etsa palo ea mehato ea ho lokisa ho tsosolosa bophelo bo botle) ​​le tse molle 600 (mmuso bo botle) le haufi le se loketseng sa, ho seng joalo tse sa lokelang bakeng sa chelete joalo ho reka koloi, ‘me joale ho phetha Litokiso).

    CLOCK и BMAL1 регулируют чувствительность мышц к инсулину с помощью SIRT1 у самцов мышей | Эндокринология

    Циркадное смещение вызывает инсулинорезистентность как у людей, так и у животных, а скелетные мышцы — это самая большая реакция органа на инсулин. Однако то, как циркадные часы регулируют чувствительность мышц к инсулину, и лежащие в основе молекулярные механизмы все еще в значительной степени неизвестны. Здесь мы показываем циркадные циклы локомоторного выброса капут (CLOCK) и ядерный транслокатор-подобный белок (BMAL) -1 мозга и мышечного арилуглеводородного рецептора, два основных фактора циркадной транскрипции, которые подавляются в инсулинорезистентных мышечных трубках C2C12 и скелетных мышцах мышей.Кроме того, передача сигналов инсулина ослабляется в скелетных мышцах Clock Δ 19 / Δ 19 мышей, и нокдаун CLOCK или BMAL1 небольшими интерферирующими РНК вызывает инсулинорезистентность в мышечных трубках C2C12. Соответственно, эктопическая экспрессия CLOCK и BMAL1 улучшает чувствительность к инсулину в мышечных трубках C2C12. Кроме того, CLOCK и BMAL1 регулируют экспрессию сиртуина 1 (SIRT1), важного регулятора чувствительности к инсулину, в мышечных трубках C2C12 и скелетных мышцах мыши, а два элемента E-box в промоторе Sirt1 отвечают за его CLOCK- и BMAL1- зависимая транскрипция в мышечных клетках.Дальнейшие исследования показывают, что CLOCK и BMAL1 регулируют чувствительность мышц к инсулину через SIRT1. Кроме того, мы обнаружили, что BMAL1 и SIRT1 уменьшаются в мышцах мышей, находящихся в постоянной темноте, а добавка ресвератрола активирует SIRT1 и улучшает чувствительность к инсулину. Все эти данные демонстрируют, что CLOCK и BMAL1 регулируют чувствительность мышц к инсулину через SIRT1, и активация SIRT1 может быть потенциально ценной стратегией для ослабления мышечной инсулинорезистентности, связанной с циркадным смещением.

    Циркадные часы влияют почти на все аспекты физиологии и поведения, включая циклы сна и бодрствования, сердечно-сосудистую деятельность, эндокринную систему, температуру тела, артериальное давление, почечную активность, физиологию желудочно-кишечного тракта, формирование памяти и метаболизм (1, 2) . Циркадное смещение было описано как множество обстоятельств, таких как несоответствующее время сна и бодрствования, смещение сна / бодрствования с ритмами кормления или смещение центральных и периферических ритмов (3).Эпидемиологические исследования показывают, что смещение циркадных ритмов увеличивает риск развития ряда заболеваний, включая ожирение и диабет 2 типа (4, 5). Инсулинорезистентность — самый мощный предиктор будущего развития диабета 2 типа, а также терапевтическая цель при наличии гипергликемии (6). Переедание, низкий уровень пищевых волокон, малоподвижный образ жизни и депрессия связаны с инсулинорезистентностью или могут привести к ней (7–9). Сообщалось также, что циркадная десинхрония у людей, характерная для сменной работы, смены часовых поясов и / или ограничения сна, коррелирует с инсулинорезистентностью или даже напрямую вызывает ее (10–12).Аналогичным образом, содержание мышей в 20-часовом световом и 20-часовом циклах темноты для нарушения эндогенных циркадных часов приводит к ускоренному увеличению веса и ожирению, повышению уровня инсулина и увеличению отношения инсулина к глюкозе, что свидетельствует о развитии инсулинорезистентности (13). . У мышей, подвергшихся постоянному освещению, наблюдается полная потеря циркадных ритмов чувствительности к инсулину (14). Циркадное смещение, вызванное постоянной темнотой, приводит к инсулинорезистентности у мышей (15).

    Центральным элементом основного часового механизма является комплекс гетеродимерных факторов транскрипции циркадных циклов локомоторного выброса капут (CLOCK) и мозговой и мышечный арилуглеводородный рецептор ядерного транслокатороподобного белка (BMAL) -1, который индуцирует экспрессию генов для двух основные осцилляторы, Per и Cry через элементы E-box (CACGTG) в своих промоторах (1, 16).Мыши с мутацией Clock показывают нормальную чувствительность к инсулину в возрасте 8 месяцев, тогда как 3-месячные Clock Δ 19 / Δ 19 мутантные мыши демонстрируют повышенную чувствительность к инсулину (17). Bmal1 «нокаутные» мыши демонстрируют поразительный худой фенотип из-за снижения подкожно жировой и мышечной ткани (18), а также демонстрируют снижение секреции инсулина и улучшенную чувствительность к инсулину всего тела (17, 19). Циркадное изменение чувствительности печени к инсулину мышей регулируется CLOCK / BMAL1 (15).Печеночно-специфическая делеция Bmal1 приводит к притуплению чувствительности к инсулину (20). Скелетные мышцы являются преобладающим местом инсулино-опосредованного поглощения глюкозы в постпрандиальном состоянии, а инсулинорезистентность скелетных мышц является ранней терапевтической мишенью у молодых инсулинорезистентных людей (21, 22). Как обычные, так и индуцируемые мышечные абляции Bmal1 вызывают снижение инсулинозависимого захвата глюкозы скелетными мышцами (23). Однако то, как циркадные часы регулируют чувствительность мышц к инсулину, и лежащие в основе молекулярные механизмы требуют дальнейшего изучения.

    Сиртуин 1 (SIRT1), гомолог дрожжевого Sir2 у млекопитающих, является NAD + -зависимой деацетилазой и важным регулятором чувствительности к инсулину (24–26). Трансгенные мыши SIRT1 демонстрируют снижение уровня инсулина в крови, глюкозы натощак и большую толерантность к глюкозе, что предполагает повышение чувствительности к инсулину (27). Опосредованная аденовирусом сверхэкспрессия SIRT1 в печени мышей ob / ob и индуцированных диетой, инсулинорезистентных мышей с дефицитом рецепторов липопротеинов низкой плотности улучшает системную инсулинорезистентность (28).Соответственно, печеночно-специфический дефицит Sirt1 вызывает перепроизводство глюкозы в печени и хроническую гипергликемию, а также приводит к увеличению продукции активных форм кислорода и нарушению передачи сигналов mTorc2 / Akt, что приводит к резистентности к инсулину (29). Сверхэкспрессия SIRT1 в мышечных трубках C2C12 предотвращает инсулинорезистентность, индуцированную жирными кислотами (24). SIRT1 повышает чувствительность к инсулину скелетных мышц у мышей во время ограничения калорийности (30). Более того, активация SIRT1 ресвератролом, природным полифенольным соединением, защищает мышей от ожирения, вызванного диетой, и инсулинорезистентности (31, 32) и улучшает чувствительность к инсулину у пациентов с диабетом 2 типа и лиц с ожирением (33, 34).SIRT1 экспрессируется циркадным образом, также связывается с CLOCK-BMAL1 циркадным образом и регулирует экспрессию генов циркадных часов посредством деацетилирования периода 2 (PER2) (35). Активность SIRT1 также имеет циркадные изменения и может функционировать как молекулярный реостат функции CLOCK-опосредованной гистонацетилтрансферазы путем деацетилирования гистона h4 и BMAL1 (36). Наше недавнее исследование показало, что циркадная экспрессия SIRT1 в печени регулируется CLOCK / BMAL1 посредством связывания с его промотором и необходима для циркадного изменения чувствительности печени к инсулину (15).Однако, участвует ли SIRT1 также в регуляции мышечной чувствительности к инсулину с помощью циркадных часов, еще предстоит выяснить.

    Здесь мы показываем, что CLOCK и BMAL1 подавляются в инсулинорезистентных мышечных трубках и скелетных мышцах и регулируют чувствительность к инсулину через SIRT1, влияя на его транскрипцию. В скелетных мышцах мышей, находящихся в постоянной темноте, наблюдаются пониженные уровни белка BMAL1 и SIRT1 и инсулинорезистентность, а добавление ресвератрола для активации SIRT1 может эффективно обратить вспять мышечную инсулинорезистентность, вызванную циркадным смещением.

    Материалы и методы

    Клеточные культуры и методы лечения

    Клеточная линия миобластов мыши C2C12 поддерживалась в среде DMEM, содержащей 10% фетальной бычьей сыворотки (FBS; Gibco), и дифференцировалась в среде DMEM с добавлением 2% лошадиной сыворотки (Gibco) после роста до 60–80% конфлюэнтности. Через 4 дня дифференцированные миотрубки C2C12 использовали для последующих экспериментов.

    Миотрубки C2C12 в 12-луночных планшетах инкубировали в среде DMEM, содержащей 10% FBS и 2% BSA в отсутствие или в присутствии 0.75 мМ пальмитата для индукции инсулинорезистентности в течение 16 часов.

    Для стимуляции инсулином клетки инкубировали в DMEM в течение 4 часов, а затем инкубировали в DMEM, содержащей 100 нМ инсулина (Sigma), в течение 15 минут и собирали для вестерн-блоттинга.

    Для трансфекции малой интерферирующей РНК (миРНК) миотрубки C2C12 в 12-луночных планшетах трансфицировали указанными миРНК в конечной концентрации 80 нМ в 1 мл культуральной среды на лунку с использованием реагента для трансфекции миРНК X-tremeGENE (Roche).

    При аденовирусной инфекции миотрубки C2C12 были инфицированы указанным аденовирусом при множественности инфицирования 200.

    После трансфекции siRNA в течение 96 часов или инфицирования аденовирусом в течение 72 часов клетки собирали для экстракции общей РНК или для Вестерн блот или стимуляция инсулином.

    Чтобы объединить трансфекцию миРНК и инфицирование аденовирусом, после трансфекции миРНК в течение 24 часов клетки инфицировали аденовирусом в течение 60 часов.Затем клетки инкубировали в культуральной среде или в среде DMEM, содержащей 10% FBS, 1% BSA и 0,5 мМ пальмитата, для индукции инсулинорезистентности в течение 12 часов, а затем стимулировали инсулином.

    Иммунофлуоресценция

    Миобласты или миотрубки

    C2C12 фиксировали 4% параформальдегидом, блокировали 5% BSA в PBS, содержащем 0,1% Triton X-100, а затем инкубировали в течение ночи при 4 ° C с антителом к ​​антимиозину (банк гибридных исследований развития), как указано в таблице 1, а затем детектируется с помощью конъюгированных с Cy3 козьих антител против IgG мыши (Jackson ImmunoResearch).Иммунофлуоресцентные изображения получали на флуоресцентном микроскопе Olympus IX51.

    6 PER2 ( ) C
    Пептид / белок-мишень . Последовательность антигена (если известна) . Название антитела . Производитель, номер по каталогу и / или имя лица, предоставляющего антитело . Выращенные виды (моноклональные или поликлональные) . Использованный раствор .
    BMAL1 C-DMIDNDQGSSSPS Анти-BMAL1 антитела, ChIP класса Abcam, ab3350 Кролик, поликлональный 1: 1000
    Анти-PER2-антитело Abcam, ab180655 Кролик, поликлональный 1: 1000
    ЧАСЫ Anti-KAT13D / CLOCK антитело-ЧИП-класс
    0 Abcam7, ab3517
    0 Abcam7, ab3517 9 поликлональные
    1: 1000
    Acetyl-RelA Анти-NFκB p65 (ацетил K310) антитела класса ChIP Abcam, ab19870 Кролик, поликлональный
    0168 1: 1000- Gsk3β
    Фосфо-GSK-3β (Ser9) антитело Cell Signaling Technology, номер 9336 Кролик, поликлональный 1: 2000
    SIRT1 SirT1 (1F3) mAb мыши Cell Signaling Technology, номер 8469 Мышь, моноклональная 1: 1000
    p53 Cell p53 (1C12) mAb мыши Technology, номер 2524 Mouse, monoclonal 1: 1000
    Acetyl-p53 Acetyl-p53 (Lys379) antibody Cell Signaling Technology, number 2570 Rabbit, polyclonal
    GAPDH GAPDH (14C11) mAb кролика Cell Signaling Technology, номер 2119 Кролик, моноклональный 1:10 000
    p-InsR p-InsR рецептор β (Tyr1131) / инсулиновый рецептор β (Tyr1146) антитело Cell Signaling Technology, номер 3021 Кролик, моноклональный 1: 1000
    p-Akt Phospho-Akt (Ser473) (19 3 h22) mAb кролика Cell Signaling Technology, номер 4058 Кролик, моноклональный 1: 1000
    RelA NFκB p65 антитело (C-20) Santa Cruz Biotechnology, sc-372 Кролик, поликлональный 1: 1000
    Миозин MF20 Банк развития гибридных исследований Мышь, моноклональная 1: 100
    6 PER2 ( ) C
    Пептид / белок-мишень . Последовательность антигена (если известна) . Название антитела . Производитель, номер по каталогу и / или имя лица, предоставляющего антитело . Выращенные виды (моноклональные или поликлональные) . Использованный раствор .
    BMAL1 C-DMIDNDQGSSSPS Анти-BMAL1 антитела, ChIP класса Abcam, ab3350 Кролик, поликлональный 1: 1000
    Анти-PER2-антитело Abcam, ab180655 Кролик, поликлональный 1: 1000
    ЧАСЫ Anti-KAT13D / CLOCK антитело-ЧИП-класс
    0 Abcam7, ab3517
    0 Abcam7, ab3517 9 поликлональные
    1: 1000
    Acetyl-RelA Анти-NFκB p65 (ацетил K310) антитела класса ChIP Abcam, ab19870 Кролик, поликлональный
    0168 1: 1000- Gsk3β
    Фосфо-GSK-3β (Ser9) антитело Cell Signaling Technology, номер 9336 Кролик, поликлональный 1: 2000
    SIRT1 SirT1 (1F3) mAb мыши Cell Signaling Technology, номер 8469 Мышь, моноклональная 1: 1000
    p53 Cell p53 (1C12) mAb мыши Technology, номер 2524 Mouse, monoclonal 1: 1000
    Acetyl-p53 Acetyl-p53 (Lys379) antibody Cell Signaling Technology, number 2570 Rabbit, polyclonal
    GAPDH GAPDH (14C11) mAb кролика Cell Signaling Technology, номер 2119 Кролик, моноклональный 1:10 000
    p-InsR p-InsR рецептор β (Tyr1131) / инсулиновый рецептор β (Tyr1146) антитело Cell Signaling Technology, номер 3021 Кролик, моноклональный 1: 1000
    p-Akt Phospho-Akt (Ser473) (19 3 h22) mAb кролика Cell Signaling Technology, номер 4058 Кролик, моноклональный 1: 1000
    RelA NFκB p65 антитело (C-20) Santa Cruz Biotechnology, sc-372 Кролик, поликлональный 1: 1000
    Миозин MF20 Банк развития гибридных исследований Мышь, моноклональная 1: 100
    6 PER2 ( ) C
    Пептид / белок-мишень . Последовательность антигена (если известна) . Название антитела . Производитель, номер по каталогу и / или имя лица, предоставляющего антитело . Выращенные виды (моноклональные или поликлональные) . Использованный раствор .
    BMAL1 C-DMIDNDQGSSSPS Анти-BMAL1 антитела, ChIP класса Abcam, ab3350 Кролик, поликлональный 1: 1000
    Анти-PER2-антитело Abcam, ab180655 Кролик, поликлональный 1: 1000
    ЧАСЫ Anti-KAT13D / CLOCK антитело-ЧИП-класс
    0 Abcam7, ab3517
    0 Abcam7, ab3517 9 поликлональные
    1: 1000
    Acetyl-RelA Анти-NFκB p65 (ацетил K310) антитела класса ChIP Abcam, ab19870 Кролик, поликлональный
    0168 1: 1000- Gsk3β
    Фосфо-GSK-3β (Ser9) антитело Cell Signaling Technology, номер 9336 Кролик, поликлональный 1: 2000
    SIRT1 SirT1 (1F3) mAb мыши Cell Signaling Technology, номер 8469 Мышь, моноклональная 1: 1000
    p53 Cell p53 (1C12) mAb мыши Technology, номер 2524 Mouse, monoclonal 1: 1000
    Acetyl-p53 Acetyl-p53 (Lys379) antibody Cell Signaling Technology, number 2570 Rabbit, polyclonal
    GAPDH GAPDH (14C11) mAb кролика Cell Signaling Technology, номер 2119 Кролик, моноклональный 1:10 000
    p-InsR p-InsR рецептор β (Tyr1131) / инсулиновый рецептор β (Tyr1146) антитело Cell Signaling Technology, номер 3021 Кролик, моноклональный 1: 1000
    p-Akt Phospho-Akt (Ser473) (19 3 h22) mAb кролика Cell Signaling Technology, номер 4058 Кролик, моноклональный 1: 1000
    RelA NFκB p65 антитело (C-20) Santa Cruz Biotechnology, sc-372 Кролик, поликлональный 1: 1000
    Миозин MF20 Банк развития гибридных исследований Мышь, моноклональная 1: 100
    6 PER2 ( ) C
    Пептид / белок-мишень . Последовательность антигена (если известна) . Название антитела . Производитель, номер по каталогу и / или имя лица, предоставляющего антитело . Выращенные виды (моноклональные или поликлональные) . Использованный раствор .
    BMAL1 C-DMIDNDQGSSSPS Анти-BMAL1 антитела, ChIP класса Abcam, ab3350 Кролик, поликлональный 1: 1000
    Анти-PER2-антитело Abcam, ab180655 Кролик, поликлональный 1: 1000
    ЧАСЫ Anti-KAT13D / CLOCK антитело-ЧИП-класс
    0 Abcam7, ab3517
    0 Abcam7, ab3517 9 поликлональные
    1: 1000
    Acetyl-RelA Анти-NFκB p65 (ацетил K310) антитела класса ChIP Abcam, ab19870 Кролик, поликлональный
    0168 1: 1000- Gsk3β
    Фосфо-GSK-3β (Ser9) антитело Cell Signaling Technology, номер 9336 Кролик, поликлональный 1: 2000
    SIRT1 SirT1 (1F3) mAb мыши Cell Signaling Technology, номер 8469 Мышь, моноклональная 1: 1000
    p53 Cell p53 (1C12) mAb мыши Technology, номер 2524 Mouse, monoclonal 1: 1000
    Acetyl-p53 Acetyl-p53 (Lys379) antibody Cell Signaling Technology, number 2570 Rabbit, polyclonal
    GAPDH GAPDH (14C11) mAb кролика Cell Signaling Technology, номер 2119 Кролик, моноклональный 1:10 000
    p-InsR p-InsR рецептор β (Tyr1131) / инсулиновый рецептор β (Tyr1146) антитело Cell Signaling Technology, номер 3021 Кролик, моноклональный 1: 1000
    p-Akt Phospho-Akt (Ser473) (19 3 h22) mAb кролика Технология передачи сигналов клеток, номер 4058 Кролик, моноклональный 1: 1000
    RelA NFκB p65 антитело (C-20) Santa Cruz Biotechnology, sc-372 Кролик, поликлональный 1: 1000
    Миозин MF20 Банк развития гибридных исследований Мышь, моноклональная 1: 100

    Анализ диметилтиазолдифенилтетразолийбромида (МТТ)

    миобластов C2C12 высевали в 96-луночные планшеты.После дифференцировки клетки обрабатывали указанными концентрациями пальмитата в течение 16 часов, а затем использовали для анализа МТТ, как описано ранее (37). Вкратце, 20 мкл 5 мг / мл МТТ, растворенного в PBS, добавляли в каждую лунку, содержащую 200 мкл культуральной среды. После инкубации при 37 ° C в течение 4 часов культуральную среду, содержащую МТТ, из каждой лунки удаляли. Кристаллы МТТ-формазана, образованные метаболически жизнеспособными клетками, растворяли в 150 мкл диметилсульфоксида и измеряли оптическую плотность при 490 нм с использованием 96-луночного планшета-ридера.

    Вестерн-блот

    Образцы белка были проанализированы с помощью антител против CLOCK, BMAL1, PER2 (Abcam), Tyr1131 / 1146-фосфорилированного (p) рецептора инсулина (p-InsR), Ser473-p-Akt, Ser9-фосфорилированной киназы гликогенсинтазы 3β (p-Gsk3β ), SIRT1, глицеральдегид-3-фосфатдегидрогеназа (GAPDH), p53, ацетил-p53 (K379) (Cell Signaling), RelA и ацетил-RelA (Santa Cruz Biotechnology), как указано в таблице 1. Каждый блот показан на рисунках представляет по крайней мере три эксперимента.Количественное определение белка анализировали с помощью ImageJ (http://rsb.info.nih.gov/ij/index.html), и значения интенсивности были нормализованы по GAPDH.

    Анализ поглощения глюкозы

    Поглощение глюкозы определяли с использованием метода, описанного ранее (38). Вкратце, клетки инкубировали в фосфатном буфере Кребса-Рингера (128 мМ NaCl; 4,7 мМ KCl; 5 мМ NaH 2 PO 4 ; 5 мМ Na 2 HPO 4 ; 1,25 мМ MgSO 4 ; 1,25. мМ CaCl 2 , pH 7.4) со 100 нМ инсулина или без него в течение 30 минут при 37 ° C. Затем добавляли [ 3 H] 2-дезоксиглюкозу (Amersham) и 2-дезоксиглюкозу до конечной концентрации 0,5 мкКи / мл и 0,05 мМ соответственно. После инкубации в течение 5 минут клетки промывали четыре раза ледяным PBS, а затем лизировали 0,2 М NaOH в течение 30 минут. Радиоактивно меченную глюкозу в лизатах измеряли в сцинтилляционной смеси с высокой температурой вспышки (PerkinElmer) с использованием жидкостного сцинтилляционного счетчика.

    Эксперименты на животных

    Все животные содержались и использовались в соответствии с руководящими принципами Институционального комитета по уходу и использованию животных Института диетологии.Мыши db / db , Clock Δ 19 / Δ 19 мышей с делецией экзона 19 в гене Clock и их однопометники дикого типа были получены из лаборатории Джексона. Мыши C57BL / 6 были получены от Slac. Мышей содержали в условиях 12-часового освещения, 12-часового цикла темноты (LD) или постоянной темноты (DD), как указано. Время Zeitgeber (ZT) 0 соответствует времени появления света, а циркадное время (CT) 0 соответствует ZT0 предыдущего цикла LD.Если не указано иное, для следующих экспериментов использовали мышей-самцов в возрасте 10 недель.

    Тесты на толерантность к инсулину были выполнены на ZT7 на db / db мышах, голодавших в течение 4 часов. Концентрации глюкозы измеряли в крови из хвоста в указанные моменты времени после внутрибрюшинной инъекции 1 Ед / кг массы тела человеческого инсулина (Novo Nordisk).

    Для изучения уровней мРНК и белка в скелетных мышцах, db / db мышей, Clock Δ 19 / Δ 19 мышей и их однопометников дикого типа были убиты в ZT7, за исключением случаев, указанных для сбора образцы четырехглавой мышцы.Для обнаружения инсулиновой передачи сигналов in vivo мыши Clock Δ 19 / Δ 19 и их однопометники голодали в течение 16 часов, а затем вводили внутрибрюшинно PBS или человеческий инсулин в дозе 5 ЕД. / кг при ZT7 в течение 15 минут и убивали для сбора образцов четырехглавой мышцы.

    Для изучения эффекта постоянной темноты 10-недельных мышей содержали в условиях 12-часового цикла света, 12-часового темного цикла или постоянной темноты. Через 22 дня мышей умерщвляли в указанные моменты времени для сбора образцов четырехглавой мышцы.

    Чтобы исследовать действие ресвератрола in vivo, 10-недельных мышей кормили трансресвератролом в концентрации 250 мг / л (Sigma) в течение 14 дней, как описано ранее (24), а затем помещали на 12-часовой свет. 12-часовой темный цикл или постоянная темнота с тем же лечением ресвератролом в течение 22 дней. Доза ресвератрола составляет около 25 мг / кг · сут, что аналогично предыдущим исследованиям (24, 39). Затем мышей умерщвляли для сбора образцов четырехглавой мышцы или голодали в течение 16 часов, а затем внутрибрюшинно вводили PBS или инсулин (Novo Nordisk) в дозе 5 Ед / кг в указанные моменты времени.Спустя пятнадцать минут мышей умерщвляли для сбора образцов четырехглавой мышцы.

    Малые интерферирующие РНК

    siRNA для часов Clock представляет собой смесь GACGAGACUGUGAGAGGAA (dTdT), CAGAGUGCUACAGUCACUA (dTdT) и AGUAUGCCACAGAACAGUA (dTdT) (где dT представляет собой дезокситимидин: 1), синтезированную соотношением B: 1. SiRNA для Bmal1 представляет собой смесь GUGCAACAGGCCUUCAGUA (dTdT), GUAUCUACCACAGGAACUU (dTdT) и UGAAUGCUUUUGGAACCAA (dTdT) от Bioneer в соотношении 1: 1: 1.SiRNA для Sirt1 представляет собой смесь GUGGCAGAUUGUUAUUAAU (dTdT) и CCGUCUCUGUGUCACAAAU (dTdT) от Genepharma в соотношении 1: 1.

    Аденовирусы

    Аденовирусы (Ads) для сверхэкспрессии зеленого флуоресцентного белка, CLOCK (Ad-CLOCK), BMAL1 (Ad-BMAL1) и SIRT1 (Ad-SIRT1) получали, как описано ранее (15).

    Выделение РНК и количественная ПЦР

    Полную РНК экстрагировали реагентом TRIzol (Invitrogen), а затем обратно транскрибировали в кДНК с использованием обратной транскриптазы вируса мышиного лейкоза Молони (Promega) со случайными гексамерными праймерами.Количественную ПЦР в реальном времени проводили с помощью системы определения последовательности ABI Prism 7900 с использованием FastStart Universal SYBR Green Master (Roche). Результаты были нормализованы до 36b4 . Праймеры были следующими: GGGCATCACCACGAAAATCTC и CTGCCGTTGTCAAACACCT для мыши 36b4 , ATGACGCTGTGGCAGATTGTT и CCGCAAGGCGAGCATAGAT для мыши Sirt1 , CCAAGAAAGTATGGACACAGACAAA и GCATTCTTGATCCTTCCTTGGT для мыши BMAL1 и AGAACTTGGCATTGAAGAGTCTC и GTCAGACCCAGAATCTTGGCT для мыши Часы .

    Плазмиды

    Плазмиды для экспрессии CLOCK (pcDNA3-CLOCK) или BMAL1 (pcDNA3-BMAL1) были любезными подарками от К. Ягиты (40). Репортерные плазмиды люциферазы pGL3-91, pGL3-629, pGL3-1487, содержащие 91, 629 и 1487 п.н. мышиный промотор Sirt1 , были сконструированы, как описано ранее (41). Мутантная репортерная плазмида люциферазы pGL3-629 с мутацией в двух E-боксах промотора Sirt1 была сконструирована, как описано ранее (15).

    Люциферазный анализ

    Миобласты

    C2C12 в 24-луночных планшетах трансфицировали люциферазной репортерной плазмидой, содержащей указанный промотор Sirt1 (0.05 мкг / лунку), pSV40-β-gal (0,05 мкг / лунку), pcDNA3-CLOCK и pcDNA3-BMAL1 или pcDNA3 (0,3 мкг / лунку) с использованием Lipofectamine 2000 (Invitrogen). После трансфекции в течение 24 часов клетки собирали для анализа люциферазы, как описано ранее (42), и нормализовали до активности β-галактозидазы, которую определяли, как описано ранее (43).

    Статистический анализ

    Данные выражены как среднее значение ± стандартное отклонение по крайней мере трех независимых экспериментов. Статистическую значимость оценивали с помощью теста Стьюдента t или одностороннего дисперсионного анализа.Различия считались статистически значимыми при P <0,05.

    Результаты

    Понижение уровня белка CLOCK и BMAL1 коррелирует с мышечной инсулинорезистентностью

    Чтобы исследовать корреляцию между ЧАСАМИ, BMAL1 и чувствительностью к инсулину в скелетных мышцах, мы обрабатывали миотрубки C2C12 пальмитатом, чтобы вызвать инсулинорезистентность, как описано ранее (24). Дифференциация миобластов C2C12 в мышечные трубки была подтверждена иммунофлуоресценцией для обнаружения экспрессии миозина (дополнительная фигура 1A).Обработка пальмитатом в течение 16 часов не оказала очевидного эффекта на морфологический вид миотрубок C2C12 при концентрации до 0,75 мМ (дополнительная фигура 1B) и имела небольшое, но значимое влияние на жизнеспособность клеток только в высокой концентрации (дополнительная фигура 1C). Инсулинорезистентность, индуцированная пальмитатом, была подтверждена нарушением индуцированного инсулином фосфорилирования InsR, Akt и Gsk3β и поглощения глюкозы (дополнительные рисунки 1, D и E). Как показано на рис. 1, A – C, пальмитат индуцировал резистентность к инсулину, а также приводил к значительному снижению уровней белка CLOCK и BMAL1.Эти данные показывают, что снижение CLOCK и BMAL1 коррелирует с инсулинорезистентностью в культивируемых мышечных трубках. Кроме того, как показано на рисунке 1, уровни белка D – F, CLOCK и BMAL1 были значительно снижены в скелетных мышцах мышей db / db , модель инсулинорезистентных мышей, подтвержденная тестом на толерантность к инсулину (дополнительный рисунок 2). Эти данные показывают, что снижение уровня белков CLOCK и BMAL1 коррелирует с мышечной инсулинорезистентностью.

    Рисунок 1

    Уровни белка CLOCK и BMAL1 в скелетных мышцах мыши и культивируемых мышечных трубках подавляются в условиях инсулинорезистентности.А. Уровни белка CLOCK, BMAL1 и индуцированное инсулином фосфорилирование InsR, Akt и Gsk3β подавлялись в инсулинорезистентных мышечных трубках C2C12, индуцированных пальмитатом. B, Количественная оценка уровней белка p-InsR, p-Akt и p-Gsk3β на панели A. C, Количественная оценка уровней белка CLOCK и BMAL1 на панели A. D, Уровни белка CLOCK, BMAL1, индуцированное инсулином фосфорилирование InsR, Akt и Gsk3β были снижены в мышцах мышей db / db по сравнению с мышами дикого типа (WT).E и F, Количественная оценка уровней белка на панели D (n = 4 для каждой группы). Уровни белка анализировали с помощью вестерн-блоттинга. *, P <.05; **, P <0,01; ***, P <.001.

    Рисунок 1

    Уровни белка CLOCK и BMAL1 в скелетных мышцах мыши и культивируемых мышечных трубках подавляются в условиях инсулинорезистентности. А. Уровни белка CLOCK, BMAL1 и индуцированное инсулином фосфорилирование InsR, Akt и Gsk3β подавлялись в инсулинорезистентных мышечных трубках C2C12, индуцированных пальмитатом.B, Количественная оценка уровней белка p-InsR, p-Akt и p-Gsk3β на панели A. C, Количественная оценка уровней белка CLOCK и BMAL1 на панели A. D, Уровни белка CLOCK, BMAL1, индуцированное инсулином фосфорилирование InsR, Akt и Gsk3β были снижены в мышцах мышей db / db по сравнению с мышами дикого типа (WT). E и F, Количественная оценка уровней белка на панели D (n = 4 для каждой группы). Уровни белка анализировали с помощью вестерн-блоттинга. *, P <.05; **, P <.01; ***, P <.001.

    CLOCK и BMAL1 регулируют чувствительность мышц к инсулину

    Чтобы выяснить, приводит ли подавление CLOCK или BMAL1 к мышечной инсулинорезистентности, мы обнаружили передачу сигналов инсулина в скелетных мышцах мышей с мутацией Clock . Как показано на фиг. 2, A и B, индуцированное инсулином фосфорилирование InsR, Akt и Gsk3β у мышей дикого типа было значительно ослаблено в скелетных мышцах мышей Clock Δ 19 / Δ 19 мышей.Более того, нокдаун CLOCK или BMAL1 с помощью siRNAs индуцировал инсулинорезистентность в мышечных трубках C2C12, как показано по пониженным уровням фосфорилирования InsR, Akt и Gsk3β (Figure 2, C – F). Соответственно, эктопическая экспрессия CLOCK и BMAL1 аденовирусом ослабляла инсулинорезистентность в мышечных трубках C2C12, индуцированную пальмитатом (рис. 2, G и H). Взятые вместе, эти данные демонстрируют, что CLOCK и BMAL1 могут регулировать чувствительность мышц к инсулину.

    Рисунок 2

    ЧАСЫ и BMAL1 регулируют чувствительность к инсулину в скелетных мышцах мыши и культивируемых мышечных трубках.A и B, Инсулино-индуцированное фосфорилирование InsR, Akt и Gsk3β в скелетных мышцах мышей дикого типа (WT) на ZT7 (A), которое было снижено в мышце Clock Δ 19 / Δ 19 мышей (B) (n = 4 для каждой группы). C и D, уровни белка CLOCK (C) и BMAL1 (D) определяли вестерн-блоттингом после трансфекции siRNA в течение 96 часов. E, нокдаун CLOCK или BMAL1, индуцированный инсулинорезистентностью в мышечных трубках C2C12, как измерено вестерн-блоттингом для индуцированного инсулином фосфорилирования InsR, Akt и Gsk3β.F, Количественная оценка уровней белка в панели E. G, Эктопическая экспрессия CLOCK и BMAL1 аденовирусом, ослабленная инсулинорезистентностью в мышечных трубках C2C12, индуцированная пальмитатом. H, Количественная оценка уровней белка в панели G, стимулированной инсулином. *, P <.05; **, P <0,01; ***, P <.001.

    Рисунок 2

    ЧАСЫ и BMAL1 регулируют чувствительность к инсулину в скелетных мышцах мыши и культивируемых мышечных трубках. A и B, Инсулино-индуцированное фосфорилирование InsR, Akt и Gsk3β в скелетных мышцах мышей дикого типа (WT) на ZT7 (A), которое было снижено в мышце Clock Δ 19 / Δ 19 мышей (B) (n = 4 для каждой группы).C и D, уровни белка CLOCK (C) и BMAL1 (D) определяли вестерн-блоттингом после трансфекции siRNA в течение 96 часов. E, нокдаун CLOCK или BMAL1, индуцированный инсулинорезистентностью в мышечных трубках C2C12, как измерено вестерн-блоттингом для индуцированного инсулином фосфорилирования InsR, Akt и Gsk3β. F, Количественная оценка уровней белка в панели E. G, Эктопическая экспрессия CLOCK и BMAL1 аденовирусом, ослабленная инсулинорезистентностью в мышечных трубках C2C12, индуцированная пальмитатом. H, Количественная оценка уровней белка в панели G, стимулированной инсулином.*, P <.05; **, P <0,01; ***, P <.001.

    CLOCK и BMAL1 регулируют экспрессию SIRT1 в мышцах

    Чтобы выявить основной механизм того, как CLOCK и BMAL1 регулируют чувствительность к инсулину мышц, был изучен SIRT1, важный регулятор чувствительности к инсулину и участвующий в чувствительности печени к инсулину, регулируемой CLOCK / BMAL1 (15). Как показано на рисунке 3А, мы обнаружили, что уровни белка SIRT1 в скелетных мышцах были увеличены при ZT13 по сравнению с таковыми при ZT1, что аналогично циркадному изменению PER2, хорошо известной мишени транскрипции CLOCK / BMAL1.Соответственно, активность SIRT1 в скелетных мышцах, на что указывают уровни ацетилирования RelA, также увеличивалась при ZT13 по сравнению с таковыми при ZT1 (рис. 3A). Более того, уровни SIRT1, PER2 и ацетилированного белка RelA в скелетных мышцах Clock Δ 19 / Δ 19 мышей были очень похожи на ZT1 и ZT13 (рис. 3B), что позволяет предположить, что SIRT1 регулируется с помощью CLOCK. с механизмом, аналогичным PER2. Чтобы дополнительно подтвердить этот вывод, мы измерили уровень и активность белка SIRT1 в скелетных мышцах дикого типа и Clock Δ 19 / Δ 19 мышей.Как показано на фиг. 3C, уровень и активность белка SIRT1 у мышей Clock Δ 19 / Δ 19 были значительно подавлены по сравнению с таковыми у мышей дикого типа, что свидетельствует о CLOCK-зависимой экспрессии SIRT1. Соответственно, нокдаун CLOCK или BMAL1 с помощью siRNA в мышечных трубках C2C12 снижает уровень и активность белка SIRT1, на что указывают уровни ацетилирования p53 (фигура 3D). Кроме того, эктопическая экспрессия CLOCK и BMAL1 аденовирусом в мышечных трубках C2C12 увеличивала уровень и активность белка SIRT1 (рис. 3E).Взятые вместе, эти результаты показывают, что CLOCK и BMAL1 регулируют уровень и активность белка SIRT1 в мышцах.

    Рисунок 3

    CLOCK и BMAL1 регулируют уровни белка SIRT1 в скелетных мышцах мышей и культивируемых мышечных трубках. А. Уровни белка CLOCK, BMAL1, SIRT1, Ac-RelA и PER2 в мышцах мышей C57BL / 6 при ZT1 и ZT13 при голодании в течение 12 часов. Ac-RelA отслеживали, чтобы указать на активность SIRT1 (n = 4 для каждой группы). Уровни белков B, SIRT1, Ac-RelA и PER2 в мышцах Clock Δ 19 / Δ 19 мышей на ZT1 и ZT13 голодали в течение 12 часов (n = 4 для каждой группы).Уровни белка C, SIRT1 и Ac-RelA в мышцах Clock Δ 19 / Δ 19 мышей на ZT7 (n = 4 для каждой группы). D, нокдаун CLOCK или BMAL1 в миотрубке C2C12 подавлял уровень и активность белка SIRT1, контролируемые ацетилированным p53. E, эктопическая экспрессия CLOCK и BMAL1 аденовирусом (Ad-C и B) в мышечных трубках C2C12, повышающая уровень и активность белка SIRT1. *, P <.05; **, P <0,01; ***, П <.001.

    Фигура 3

    CLOCK и BMAL1 регулируют уровни белка SIRT1 в скелетных мышцах мыши и культивируемых мышечных трубках. А. Уровни белка CLOCK, BMAL1, SIRT1, Ac-RelA и PER2 в мышцах мышей C57BL / 6 при ZT1 и ZT13 при голодании в течение 12 часов. Ac-RelA отслеживали, чтобы указать на активность SIRT1 (n = 4 для каждой группы). Уровни белков B, SIRT1, Ac-RelA и PER2 в мышцах Clock Δ 19 / Δ 19 мышей на ZT1 и ZT13 голодали в течение 12 часов (n = 4 для каждой группы).Уровни белка C, SIRT1 и Ac-RelA в мышцах Clock Δ 19 / Δ 19 мышей на ZT7 (n = 4 для каждой группы). D, нокдаун CLOCK или BMAL1 в миотрубке C2C12 подавлял уровень и активность белка SIRT1, контролируемые ацетилированным p53. E, эктопическая экспрессия CLOCK и BMAL1 аденовирусом (Ad-C и B) в мышечных трубках C2C12, повышающая уровень и активность белка SIRT1. *, P <.05; **, P <0,01; ***, П <.001.

    Два элемента E-box в промоторе

    Sirt1 необходимы для его CLOCK- и BMAL1-зависимой транскрипции в мышечных клетках

    Чтобы выяснить, как CLOCK и BMAL1 регулируют уровень белка SIRT1, мы измерили уровни мРНК Sirt1 в скелетных мышцах мышей дикого типа и Clock Δ 19 / Δ 19 мышей. Как показано на фиг. 4A, уровни мРНК Sirt1 в Clock Δ 19 / Δ 19 мышей были значительно подавлены по сравнению с таковыми у мышей дикого типа.Более того, нокдаун CLOCK или BMAL1 с помощью siRNA в мышечных трубках C2C12 заметно снижал уровень мРНК Sirt1 (Рисунок 4B). Соответственно, эктопическая экспрессия CLOCK и BMAL1 аденовирусом в мышечных трубках C2C12 увеличивала уровень мРНК Sirt1 (Рисунок 4C). Эти данные демонстрируют, что CLOCK и BMAL1 регулируют уровень мРНК Sirt1 в мышечных клетках.

    Рисунок 4

    CLOCK и BMAL1 связываются с промотором Sirt1 и увеличивают его транскрипцию.Уровень мРНК A, Sirt1 был снижен в мышцах мышей Clock Δ 19 / Δ 19 (n = 4). B, нокдаун CLOCK или BMAL1 в миотрубках C2C12 подавлял уровень мРНК Sirt1 . Ctrl, контроль. C, эктопическая экспрессия CLOCK и BMAL1 аденовирусом в мышечных трубках C2C12, повышающая уровень мРНК Sirt1 . D. Влияние CLOCK и BMAL1 на экспрессию люциферазы под контролем указанных фрагментов промотора Sirt1 в миобластах C2C12.E. Расположение двух предсказанных E-боксов в промоутере Sirt1 . F. Мутация двух E-боксов ослабляла активацию промотора 629 bp Sirt1 под действием CLOCK и BMAL1 в миобластах C2C12. *, P <.05; **, P <0,01; ***, P <.001.

    Рисунок 4

    CLOCK и BMAL1 связываются с промотором Sirt1 и увеличивают его транскрипцию. Уровень мРНК A, Sirt1 был снижен в мышцах мышей Clock Δ 19 / Δ 19 (n = 4).B, нокдаун CLOCK или BMAL1 в миотрубках C2C12 подавлял уровень мРНК Sirt1 . Ctrl, контроль. C, эктопическая экспрессия CLOCK и BMAL1 аденовирусом в мышечных трубках C2C12, повышающая уровень мРНК Sirt1 . D. Влияние CLOCK и BMAL1 на экспрессию люциферазы под контролем указанных фрагментов промотора Sirt1 в миобластах C2C12. E. Расположение двух предсказанных E-боксов в промоутере Sirt1 . F. Мутация двух E-боксов ослабляла активацию промотора 629 bp Sirt1 под действием CLOCK и BMAL1 в миобластах C2C12.*, P <.05; **, P <0,01; ***, P <.001.

    Чтобы исследовать, регулируется ли изменение уровня мРНК Sirt1 в мышечных клетках на уровне транскрипции, были использованы репортеры люциферазы с промотором Sirt1 длиной 91, 629 или 1487 п.н. для анализа их транскрипционной активности. Как и ожидалось, эктопическая экспрессия CLOCK и BMAL1 заметно увеличивала транскрипционную активность промотора Sirt1 длиной 629 и 1487 п.о., но не влияла на активность промотора Sirt1 длиной 91 п.н. (рис. 4D).Было показано, что CLOCK и BMAL1 связываются с элементами E-бокса и активируют транскрипцию (44). Как показано на фиг. 4E, есть два элемента E-box, 103 или 175 п.н. перед инициирующим кодоном Sirt1 . Мутация двух E-боксов в промоторе 629 bp Sirt1 нарушила эффект CLOCK и BMAL1 на его транскрипционную активность (рис. 4F).

    Эти данные предполагают, что CLOCK и BMAL1 связываются с E-боксами в промоторе Sirt1 и увеличивают его транскрипцию в мышечных клетках.

    CLOCK и BMAL1 регулируют чувствительность мышц к инсулину с помощью SIRT1

    Учитывая эти данные выше, мы предположили, что CLOCK и BMAL1 регулируют чувствительность к инсулину в мышечных клетках SIRT1-зависимым образом. Как показано на Рисунке 5, A – C, CLOCK и BMAL1 не смогли ослабить инсулинорезистентность, индуцированную пальмитатом в мышечных трубках C2C12, с нокдауном SIRT1. Кроме того, эктопическая экспрессия SIRT1 аденовирусом улучшает инсулинорезистентность, вызванную нокдауном BMAL1 или CLOCK в мышечных трубках C2C12 (Рисунок 5, D – F).Эти данные показывают, что CLOCK и BMAL1 регулируют чувствительность мышц к инсулину через SIRT1.

    Рисунок 5

    CLOCK и BMAL1 регулируют чувствительность к инсулину через SIRT1 в культивируемых мышечных трубках. A, CLOCK и BMAL1 не смогли ослабить резистентность к инсулину, индуцированную пальмитатом в мышечных трубках C2C12, с нокдауном SIRT1. Ctrl, контроль. B и C, Количественная оценка уровней белков p-InsR, p-Akt и p-Gsk3β на панели A. D, Эктопическая экспрессия SIRT1 улучшала резистентность к инсулину, индуцированную нокдауном BMAL1 или CLOCK в мышечных трубках C2C12.E и F, Количественное определение уровней белков p-InsR, p-Akt и p-Gsk3β на панели D. *, P <0,05; **, P <0,01; ***, P <.001.

    Рисунок 5

    ЧАСЫ и BMAL1 регулируют чувствительность к инсулину через SIRT1 в культивируемых мышечных трубках. A, CLOCK и BMAL1 не смогли ослабить резистентность к инсулину, индуцированную пальмитатом в мышечных трубках C2C12, с нокдауном SIRT1. Ctrl, контроль. B и C: Количественная оценка уровней белков p-InsR, p-Akt и p-Gsk3β на панели A.D, внематочная экспрессия SIRT1 улучшает инсулинорезистентность, вызванную нокдауном BMAL1 или CLOCK в мышечных трубках C2C12. E и F, Количественное определение уровней белков p-InsR, p-Akt и p-Gsk3β на панели D. *, P <0,05; **, P <0,01; ***, P <.001.

    Ресвератрол увеличивает активность SIRT1 и ослабляет мышечную инсулинорезистентность, вызванную циркадным смещением

    Чтобы проверить влияние циркадного смещения на SIRT1 и чувствительность к инсулину, мы использовали лишение света в качестве модели циркадного смещения.После выдерживания в постоянной темноте в течение 2 недель, циркадный паттерн экспрессии белка BMAL1 в скелетных мышцах мыши был нарушен (дополнительный рисунок 3, A и B), а уровни белков BMAL1 и SIRT1 в мышцах заметно снизились при ZT / CT7. , тогда как уровни белка CLOCK были почти такими же (рис. 6А). Сообщалось, что ресвератрол вызывает активацию SIRT1 и снижает инсулинорезистентность, связанную со снижением SIRT1 (24, 39). Чтобы изучить, может ли ресвератрол также улучшить инсулинорезистентность, связанную со снижением SIRT1, вызванным постоянной темнотой, мышей кормили ресвератролом в дозе 25 мг / кг · день в нормальных условиях в течение 14 дней.Затем мышей непрерывно кормили ресвератролом и держали в постоянной темноте в течение 22 дней. Впоследствии активность SIRT1 оценивали путем определения уровней ацетилирования p53 и RelA, двух известных мишеней SIRT1. Как показано на Фигуре 6B, уровни ацетилирования p53 и RelA были заметно увеличены в мышцах мышей в постоянной темноте при ZT / CT7, что указывает на снижение активности SIRT1. Как и ожидалось, кормление ресвератролом ослабило отрицательный эффект постоянной темноты на активность SIRT1 в мышцах при ZT / CT7 (рис. 6В).Более того, постоянное индуцированное темнотой нарушение передачи сигналов инсулина в мышцах на уровне ZT / CT7, включая сниженное индуцированное инсулином фосфорилирование InsR, Akt и Gsk3β, также было обращено кормлением ресвератролом (фигура 6C). Когда мышей непрерывно кормили ресвератролом и все еще поддерживали их нормальные условия в течение 22 дней, ресвератрол оказывал небольшое, но не существенное влияние на передачу сигналов инсулина в скелетных мышцах на ZT7 (дополнительная фигура 4). Точно так же ресвератрол также значительно увеличивал уровень и активность белка SIRT1 в скелетных мышцах мышей и ослаблял мышечную инсулинорезистентность, вызванную постоянной темнотой на ZT / CT1 и ZT / CT13 (рис. 6, D – G).Взятые вместе, эти данные демонстрируют, что ресвератрол может улучшить чувствительность мышц к инсулину в постоянной темноте.

    Рисунок 6

    Ресвератрол увеличивает активность SIRT1 и ослабляет мышечную инсулинорезистентность, вызванную циркадным смещением. A: уровни белка CLOCK, BMAL1 и SIRT1 в мышцах мышей в условиях света / темноты (LD) и постоянной темноты (DD) при ZT / CT7 (n = 5 для каждой группы). B. Ресвератрол (RSV) увеличивал уровень и активность белка SIRT1 в мышцах мышей в условиях постоянной темноты (DD) на CT7.На активность SIRT1 указывали уровни ацетилирования p53 и RelA с помощью вестерн-блоттинга (n = 8 для каждой группы). C — Инсулино-индуцированное фосфорилирование InsR, Akt и Gsk3β в мышцах мышей, получавших носитель или ресвератрол в условиях LD или DD при ZT / CT (n = 8–9 для каждой группы). D – G, ресвератрол увеличивал уровень и активность белка SIRT1 (D и F) и ослаблял мышечную инсулинорезистентность, вызванную постоянной темнотой (E и G) при ZT / CT1 и ZT / CT13 (n = 5–8 для каждой группы). *, P <.05, **, P <0,01, ***, P <0,001 по ANOVA; #, P > 0,05 по ANOVA, P <0,05 по критерию Стьюдента t .

    Рис. 6

    Ресвератрол увеличивает активность SIRT1 и ослабляет мышечную инсулинорезистентность, вызванную циркадным смещением. A: уровни белка CLOCK, BMAL1 и SIRT1 в мышцах мышей в условиях света / темноты (LD) и постоянной темноты (DD) при ZT / CT7 (n = 5 для каждой группы). B. Ресвератрол (RSV) увеличивал уровень и активность белка SIRT1 в мышцах мышей в условиях постоянной темноты (DD) на CT7.На активность SIRT1 указывали уровни ацетилирования p53 и RelA с помощью вестерн-блоттинга (n = 8 для каждой группы). C — Инсулино-индуцированное фосфорилирование InsR, Akt и Gsk3β в мышцах мышей, получавших носитель или ресвератрол в условиях LD или DD при ZT / CT (n = 8–9 для каждой группы). D – G, ресвератрол увеличивал уровень и активность белка SIRT1 (D и F) и ослаблял мышечную инсулинорезистентность, вызванную постоянной темнотой (E и G) при ZT / CT1 и ZT / CT13 (n = 5–8 для каждой группы). *, P <.05, **, P <0,01, ***, P <0,001 по ANOVA; #, P > 0,05 по ANOVA, P <0,05 по критерию Стьюдента t .

    Обсуждение

    В этом исследовании мы показываем, что снижение уровня белка CLOCK или BMAL1 связано с мышечной инсулинорезистентностью. Наше наблюдение согласуется с предыдущим отчетом о том, что специфическая для мышц абляция Bmal1 вызывает нарушение инсулинозависимого захвата глюкозы скелетными мышцами (23).Более того, наше наблюдение также согласуется с тем фактом, что смещение циркадных ритмов связано с инсулинорезистентностью у людей (12), а экспрессия CLOCK или BMAL1 в печени подавляется в условиях резистентности к инсулину (15). Кроме того, мы показываем, что нокдаун CLOCK или BMAL1 siRNAs вызывает мышечную инсулинорезистентность в мышечных трубках C2C12, а постоянная темнота подавляет BMAL1 и индуцирует инсулинорезистентность в мышцах. Точно так же сообщалось, что чувствительность к инсулину в скелетных мышцах, представленная потреблением глюкозы, также проявляет циркадные колебания (45, 46), а специфическая для мышц делеция Bmal1 ухудшает чувствительность к инсулину в скелетных мышцах (23).Эти результаты также согласуются с наблюдениями, что циркадное смещение вызывает инсулинорезистентность у людей (10, 11), а циркадное смещение из-за сокращения цикла свет / темнота или воздействия постоянного света приводит к инсулинорезистентности или потере циркадных ритмов инсулина. чувствительность у мышей (13, 14). Более того, мы демонстрируем, что эктопическая экспрессия CLOCK и BMAL1 в мышечных трубках C2C12 улучшает инсулинорезистентность, индуцированную пальмитатом. В соответствии с этим наблюдением, инъекция в хвостовую вену аденовирусов, экспрессирующих CLOCK и BMAL1, улучшает толерантность к инсулину у мышей db / db (15), а мыши, получавшие диету с высоким содержанием жиров в ограниченном по времени образом с равным потреблением калорий, демонстрируют увеличение соотношения пикового и минимального уровней мРНК BMAL1 и CLOCK, улучшение толерантности к глюкозе и снижение уровня инсулина натощак (47).Постоянная темнота считается автономным циркадным состоянием (48, 49). Кроме того, сообщалось, что ограниченное по времени кормление может увеличить амплитуду циркадных часов и предотвратить метаболические заболевания у мышей, получавших диету с высоким содержанием жиров (47), и мы наблюдали, что постоянная темнота снижает уровень белка BMAL1 в мышцах при ZT / CT7. Таким образом, возможно, что постоянная темнота может также уменьшить амплитуду циркадных часов в дополнение к стимулированию свободного хода циркадных часов и, таким образом, в конечном итоге привести к резистентности к инсулину в скелетных мышцах мышей.Все эти данные показывают, что CLOCK и BMAL1 участвуют в регуляции мышечной чувствительности к инсулину, и позволяют предположить, что поддержание нормальной циркадной экспрессии CLOCK и BMAL1 может быть полезным для предотвращения метаболических нарушений в мышцах.

    Было показано, что SIRT1, главный метаболический регулятор, регулируется различными транскрипционными факторами (50). В этом исследовании мы демонстрируем, что экспрессия SIRT1 регулируется двумя основными факторами циркадной транскрипции, CLOCK и BMAL1, и два элемента E-box в промоторе Sirt1 необходимы для его CLOCK- и BMAL1-зависимой транскрипции в мышечных клетках.Сообщалось, что SIRT1 связывается с CLOCK, BMAL1 и PER2 и деацетилирует BMAL1 и PER2, регулируя циркадные часы (35, 36). Таким образом, CLOCK / BMAL1-SIRT1 может образовывать петлю обратной связи, связывающую циркадные часы и метаболизм в мышцах. Исследования показали, что сверхэкспрессия SIRT1 замедляет дифференцировку мышц за счет деацетилирования и репрессии MyoD, главного регулятора миогенеза (51). Сообщалось, что CLOCK / BMAL1 связывается с основным энхансером MyoD и активирует его транскрипцию и экспрессию и является необходимым для поддержания фенотипа и функции скелетных мышц (52).В сочетании с нашими открытиями, CLOCK / BMAL1 и SIRT1 могут координироваться, чтобы регулировать MyoD и дифференцировку и функцию скелетных мышц. В скелетных мышцах SIRT1, как сообщается, регулирует ацетилирование и транскрипцию PGC-1α (53, 54), что может стимулировать экспрессию CLOCK и BMAL1 в мышечных трубках C2C12 (55). Таким образом, SIRT1, PGC-1α и CLOCK / BMAL1 могут образовывать петлю положительной обратной связи для управления метаболизмом, митохондриальным биогенезом и циркадными часами в мышцах.

    Сообщается, что SIRT1 является важным регулятором чувствительности к инсулину в ключевых тканях-мишенях инсулина (24–26) и необходим для нормального циркадного изменения чувствительности печени к инсулину (15).Здесь мы демонстрируем, что SIRT1 опосредует регулируемую CLOCK / BMAL1 чувствительность мышечного инсулина в культивируемых мышечных клетках. Точно так же избыточная экспрессия SIRT1 в мышечных трубках C2C12 предотвращает индуцированную пальмитатом резистентность к инсулину (24), а сверхэкспрессия SIRT1 в скелетных мышцах крыс путем электропорации ослабляет мышечную инсулинорезистентность, вызванную диетой с высоким содержанием жиров (56). Все эти данные показывают, что SIRT1 может улучшить чувствительность мышц к инсулину в различных условиях инсулинорезистентности. Ресвератрол может активировать SIRT1 и защищать мышей от ожирения и инсулинорезистентности, вызванных диетой (24, 31, 32).Более того, ресвератрол может снижать инсулинорезистентность миотрубок C2C12 через SIRT1 (24). Точно так же мы показываем, что добавка ресвератрола снижает мышечную инсулинорезистентность у мышей, вызванную постоянной темнотой. Все эти результаты показывают, что CLOCK / BMAL1-зависимая транскрипция SIRT1 участвует в регуляции чувствительности к инсулину мышц, и предполагают, что активация SIRT1 небольшими молекулами, такими как ресвератрол, может быть полезной для ослабления мышечной инсулинорезистентности.

    В совокупности это исследование показывает, что подавление CLOCK / BMAL1 коррелирует с мышечной инсулинорезистентностью, а CLOCK / BMAL1 регулирует чувствительность к мышечному инсулину через SIRT1, усиливая его транскрипцию.Кроме того, добавка ресвератрола улучшает мышечную чувствительность к инсулину у мышей в условиях постоянной темноты. Наши результаты дают представление о координации циркадных часов и метаболизма в мышцах, а также о потенциальной стратегии борьбы с инсулинорезистентностью мышц, коррелирующей с циркадными нарушениями.

    Приложение

    Благодарности

    Мы благодарим Kazuhiro Yagita (Кафедра анатомии и мозговых наук, Медицинский факультет Университета Кобе, Кобе, Япония) за предоставление плазмид, экспрессирующих CLOCK и BMAL1.

    Эта работа поддержана грантами 31470768, 81321062, 31200595, 31200591 и 81472181 Национального фонда естественных наук Китая; Национальная программа фундаментальных исследований Китая, грант 2014CB542300; Программа инновационных знаний Шанхайского института биологических наук, Грант Китайской академии наук 2014KIP106; и Программа международного партнерства для творческих исследовательских групп Китайской академии наук / Государственного управления по делам иностранных экспертов.

    Раскрытие информации: авторам нечего раскрывать.

    Сокращения

    • Ad

    • BMAL

      мозговой и мышечный арилуглеводородный рецептор ядерный транслокатор-подобный белок

    • ЧАСЫ

      Циклы циркадной локомоторной отдачи kaput

    • CT

    • d

    • FBS

    • GAPDH

      глицеральдегид-3-фосфатдегидрогеназа

    • Gsk3β

      киназа гликогенсинтазы 3β

    • час светлый

      12399 цикл
    • светлый цикл

    • МТТ

      диметилтиазол-дифенилтетразолийбромид

    • p

    • PER2

    • siRNA 9066

    • SIRT1

    4

    1

    Экель-Махан

    K

    ,

    Sassone-Corsi

    P

    .

    Контроль метаболизма по циркадным часам и наоборот

    .

    Нат Структ Мол Биол

    .

    2009

    ;

    16

    :

    462

    467

    ,2

    Фрой

    O

    .

    Взаимосвязь между питанием и циркадными ритмами у млекопитающих

    .

    Фронт нейроэндокринол

    .

    2007

    ;

    28

    :

    61

    71

    ,3

    Baron

    кг

    ,

    Reid

    KJ

    .

    Циркадное смещение и здоровье

    .

    Int Rev Psychiatry

    .

    2014

    ;

    26

    :

    139

    154

    ,4

    Ruger

    M

    ,

    Scheer

    FA

    .

    Влияние нарушения циркадных ритмов на кардиометаболическую систему

    .

    Ред. Endocr Metab Disord

    .

    2009

    ;

    10

    :

    245

    260

    ,5

    Marcheva

    B

    ,

    Ramsey

    KM

    ,

    Peek

    CB

    ,

    Affinati

    A

    ,

    Maury

    E Бас

    Дж

    .

    Циркадные часы и обмен веществ

    .

    Handb Exp Pharmacol

    .

    2013

    :

    127

    155

    ,6

    Тейлор

    R

    .

    Инсулинорезистентность и диабет 2 типа

    .

    Диабет

    .

    2012

    ;

    61

    :

    778

    779

    ,7

    Ylonen

    K

    ,

    Saloranta

    C

    ,

    Kronberg-Kippila

    C

    и др. .

    Связь пищевых волокон с метаболизмом глюкозы у недиабетических родственников пациентов с диабетом 2 типа — исследование Botnia Dietary Study

    .

    Уход за диабетом

    .

    2003

    ;

    26

    :

    1979

    1985

    ,8

    Soare

    A

    ,

    Weiss

    EP

    ,

    Pozzilli

    P

    .

    Преимущества ограничения калорий для кардиометаболического здоровья, включая риск сахарного диабета 2 типа

    .

    Diabetes Metab Res Ред.

    .

    2014

    ;

    30

    :

    41

    47

    ,9

    Pearson

    S

    ,

    Schmidt

    M

    ,

    Patton

    G

    и др..

    Поперечные ассоциации депрессии и инсулинорезистентности у молодых людей

    .

    Уход за диабетом

    .

    2010

    ;

    33

    :

    1128

    1133

    .10

    Бакстон

    OM

    ,

    Павлова

    M

    ,

    Рид

    EW

    ,

    Ван

    W

    ,

    DC Simonson

    Адлер

    ГК

    .

    Ограничение сна на 1 неделю снижает чувствительность к инсулину у здоровых мужчин

    .

    Диабет

    .

    2010

    ;

    59

    :

    2126

    2133

    .11

    Leproult

    R

    ,

    Holmback

    U

    ,

    Van Cauter

    E

    .

    Циркадное смещение увеличивает маркеры инсулинорезистентности и воспаления, независимо от потери сна

    .

    Диабет

    .

    2014

    ;

    63

    :

    1860

    1869

    .12

    Nagaya

    T

    ,

    Yoshida

    H

    ,

    Takahashi

    F

    ,

    Kawai

    M

    .

    Маркеры инсулинорезистентности у дневных и сменных рабочих 30–59 лет

    .

    Int Arch Occup Environ Health

    .

    2002

    ;

    75

    :

    562

    568

    .13

    Karatsoreos

    IN

    ,

    Bhagat

    S

    ,

    Bloss

    EB

    ,

    Morrison

    JH

    ,

    McEwen

    Нарушение циркадных часов имеет разветвления для метаболизма, мозга и поведения

    .

    Proc Natl Acad Sci USA

    .

    2011

    ;

    108

    :

    1657

    1662

    ,14

    Coomans

    CP

    ,

    van den Berg

    SA

    ,

    Houben

    T

    и др. .

    Вредное влияние постоянного воздействия света и диеты с высоким содержанием жиров на циркадный энергетический метаболизм и чувствительность к инсулину

    .

    FASEB J

    .

    2013

    ;

    27

    :

    1721

    1732

    .15

    Чжоу

    B

    ,

    Чжан

    Y

    ,

    Чжан

    F

    и др..

    CLOCK / BMAL1 регулирует циркадные изменения чувствительности печени мышей к инсулину с помощью SIRT1

    .

    Гепатология

    .

    2014

    ;

    59

    :

    2196

    2206

    .16

    Зеленый

    CB

    ,

    Takahashi

    JS

    ,

    Bass

    J

    .

    Измеритель обмена веществ

    .

    Ячейка

    .

    2008

    ;

    134

    :

    728

    742

    .17

    Марчева

    B

    ,

    Ramsey

    KM

    ,

    Buhr

    ED

    и др..

    Нарушение работы компонентов часов CLOCK и BMAL1 приводит к гипоинсулинемии и диабету

    .

    Природа

    .

    2010

    ;

    466

    :

    627

    631

    ,18

    Брей

    MS

    ,

    Янг

    ME

    .

    Роль клеточно-специфичных циркадных часов в метаболизме и заболеваниях

    .

    Obes Ред.

    .

    2009

    ;

    10

    (

    доп. 2

    ):

    6

    13

    .19

    Rudic

    RD

    ,

    McNamara

    P

    ,

    Curtis

    AM

    и др. .

    BMAL1 и CLOCK, два важных компонента циркадных часов, участвуют в гомеостазе глюкозы

    .

    ПЛоС Биол

    .

    2004

    ;

    2

    :

    e377

    .20

    Lamia

    KA

    ,

    Storch

    KF

    ,

    Weitz

    CJ ​​

    .

    Физиологическое значение циркадных часов периферических тканей

    .

    Proc Natl Acad Sci USA

    .

    2008

    ;

    105

    :

    15172

    15177

    ,21

    DeFronzo

    RA

    ,

    Tripathy

    D

    .

    Инсулинорезистентность скелетных мышц является основным дефектом при диабете 2 типа

    .

    Уход за диабетом

    .

    2009

    ;

    32

    :

    S157

    S163

    .22

    Rabol

    R

    ,

    Petersen

    KF

    ,

    Dufour

    S

    ,

    Flannery

    C

    ,

    GulmanI

    .

    Обращение мышечной инсулинорезистентности с помощью упражнений снижает постпрандиальный печеночный липогенез de novo у инсулинорезистентных лиц

    .

    Proc Natl Acad Sci USA

    .

    2011

    ;

    108

    :

    13705

    13709

    .23

    Dyar

    KA

    ,

    Ciciliot

    S

    ,

    Wright

    LE

    и др. .

    Чувствительность мышц к инсулину и метаболизм глюкозы контролируются внутренними мышечными часами

    .

    Мол Метаб

    .

    2014

    ;

    3

    :

    29

    41

    .24

    Sun

    C

    ,

    Zhang

    F

    ,

    Ge

    XJ

    и др. .

    SIRT1 улучшает чувствительность к инсулину в условиях инсулинорезистентности, подавляя PTP1B

    .

    Ячейка Метаб

    .

    2007

    ;

    6

    :

    307

    319

    ,25

    Лян

    F

    ,

    Куме

    S

    ,

    Койя

    D

    .

    SIRT1 и инсулинорезистентность

    .

    Нат Рев Эндокринол

    .

    2009

    ;

    5

    :

    367

    373

    .26

    Gillum

    MP

    ,

    Erion

    DM

    ,

    Shulman

    GI

    .

    Сиртуин-1 регуляция метаболизма млекопитающих

    .

    Тенденции Мол Мед

    .

    2011

    ;

    17

    :

    8

    13

    .27

    Bordone

    L

    ,

    Cohen

    D

    ,

    Robinson

    A

    и др..

    Трансгенные мыши SIRT1 демонстрируют фенотип, напоминающий ограничение

    калорий.

    Ячейка старения

    .

    2007

    ;

    6

    :

    759

    767

    ,28

    Li

    Y

    ,

    Xu

    S

    ,

    Giles

    A

    и др. .

    Сверхэкспрессия SIRT1 в печени у мышей ослабляет стресс эндоплазматического ретикулума и резистентность к инсулину в печени

    .

    FASEB J

    .

    2011

    ;

    25

    :

    1664

    1679

    .29

    Wang

    RH

    ,

    Kim

    HS

    ,

    Xiao

    C

    ,

    Xu

    X

    ,

    Gavrilova

    O

    ,

    Deng

    CX

    .

    Дефицит печеночного Sirt1 у мышей нарушает передачу сигналов mTorc2 / Akt и приводит к гипергликемии, окислительному повреждению и резистентности к инсулину

    .

    Дж. Клин Инвест

    .

    2011

    ;

    121

    :

    4477

    4490

    .30

    Schenk

    S

    ,

    McCurdy

    CE

    ,

    Philp

    A

    и др..

    Sirt1 повышает чувствительность к инсулину скелетных мышц у мышей во время ограничения калорийности

    .

    Дж. Клин Инвест

    .

    2011

    ;

    121

    :

    4281

    4288

    .31

    Baur

    JA

    ,

    Pearson

    KJ

    ,

    Цена

    NL

    и др. .

    Ресвератрол улучшает здоровье и выживаемость мышей на высококалорийной диете

    .

    Природа

    .

    2006

    ;

    444

    :

    337

    342

    .32

    Lagouge

    M

    ,

    Argmann

    C

    ,

    Gerhart-Hines

    Z

    и др. .

    Ресвератрол улучшает функцию митохондрий и защищает от метаболических нарушений, активируя SIRT1 и PGC-1α

    .

    Ячейка

    .

    2006

    ;

    127

    :

    1109

    1122

    .33

    Brasnyo

    P

    ,

    Molnar

    GA

    ,

    Mohas

    M

    и др..

    Ресвератрол улучшает чувствительность к инсулину, снижает окислительный стресс и активирует путь Akt у пациентов с диабетом 2 типа

    .

    Br J Nutr

    .

    2011

    ;

    106

    :

    383

    389

    .34

    Timmers

    S

    ,

    Konings

    E

    ,

    Bilet

    L

    и др. .

    Эффекты 30-дневного приема ресвератрола, похожие на ограничение калорий, на энергетический обмен и метаболический профиль у людей с ожирением

    .

    Ячейка Метаб

    .

    2011

    ;

    14

    :

    612

    622

    .35

    Asher

    G

    ,

    Gatfield

    D

    ,

    Stratmann

    M

    и др. .

    SIRT1 регулирует экспрессию гена циркадных часов посредством деацетилирования PER2

    .

    Ячейка

    .

    2008

    ;

    134

    :

    317

    328

    ,36

    Накахата

    Y

    ,

    Калузова

    M

    ,

    Grimaldi

    B

    и др..

    NAD (+) — зависимая деацетилаза SIRT1 модулирует CLOCK-опосредованное ремоделирование хроматина и контроль циркадных ритмов

    .

    Ячейка

    .

    2008

    ;

    134

    :

    329

    340

    .37

    Feng

    XT

    ,

    Wang

    TZ

    ,

    Ленг

    J

    и др. .

    Пальмитат способствует развитию инсулинорезистентности за счет подавления Src-опосредованного фосфорилирования Akt в мышечных трубках C2C12

    .

    Биоси Биотехнология Биохим

    .

    2012

    ;

    76

    :

    1356

    1361

    .38

    Jove

    M

    ,

    Planavila

    A

    ,

    Sanchez

    RM

    ,

    Merlos

    M

    ,

    Laguna

    Jove

    Laguna

    Васкес-Каррера

    M

    .

    Пальмитат индуцирует экспрессию фактора некроза опухоли-α в клетках скелетных мышц C2C12 посредством механизма, включающего активацию протеинкиназы C и ядерного фактора-κB

    .

    Эндокринология

    .

    2006

    ;

    147

    :

    552

    561

    ,39

    Цена

    NL

    ,

    Gomes

    AP

    ,

    Ling

    AJY

    и др. .

    SIRT1 необходим для активации AMPK и благотворного воздействия ресвератрола на функцию митохондрий

    .

    Ячейка Метаб

    .

    2012

    ;

    15

    :

    675

    690

    .40

    Yamaguchi

    S

    ,

    Mitsui

    S

    ,

    Yan

    L

    ,

    Yagita

    K

    ,

    Miyake

    ,

    Miyake

    ,

    Miyake

    Окамура

    Н

    .

    Роль ДАД в циркадном колебательном механизме

    .

    Мол Клетки Биол

    .

    2000

    ;

    20

    :

    4773

    4781

    .41

    Jin

    Q

    ,

    Zhang

    F

    ,

    Yan

    T

    и др. .

    C / EBPα регулирует экспрессию SIRT1 во время адипогенеза

    .

    Ячейка Res

    .

    2010

    ;

    20

    :

    470

    479

    .42

    Balaguer

    P

    ,

    Francois

    F

    ,

    Comunale

    F

    и др..

    Репортерные клеточные линии для изучения эстрогенных эффектов ксеноэстрогенов

    .

    Научно-исследовательский центр общей окружающей среды

    .

    1999

    ;

    233

    :

    47

    56

    .43

    Chen

    Y

    ,

    McMicken

    HW

    .

    Внутриклеточное производство ДНК-фермента новым вектором экспрессии одноцепочечной ДНК

    .

    Джин Тер

    .

    2003

    ;

    10

    :

    1776

    1780

    .44

    Доэрти

    CJ ​​

    ,

    Кей

    SA

    .

    Циркадный контроль глобальных паттернов экспрессии генов

    .

    Анну Рев Генет

    .

    2010

    ;

    44

    :

    419

    444

    .45

    Feneberg

    R

    ,

    Lemmer

    B

    .

    Циркадный ритм поглощения глюкозы культурами клеток скелетных мышц и адипоцитов у крыс Вистар-Киото, Вистар, Гото-Какизаки и спонтанно гипертензивных крыс

    .

    Хронобиол Инт

    .

    2004

    ;

    21

    :

    521

    538

    .46

    Leighton

    B

    ,

    Kowalchuk

    JM

    ,

    Challiss

    RAJ

    ,

    Newsholme

    EA

    .

    Циркадный ритм чувствительности метаболизма глюкозы к инсулину в камбаловидной мышце крысы

    .

    Am J Physiol Endocrinol Metab

    .

    1988

    ;

    255

    :

    E41

    E45

    .47

    Hatori

    M

    ,

    Vollmers

    C

    ,

    Zarrinpar

    A

    и др..

    Ограниченное по времени кормление без снижения потребления калорий предотвращает метаболические заболевания у мышей, получавших диету с высоким содержанием жиров

    .

    Ячейка Метаб

    .

    2012

    ;

    15

    :

    848

    860

    .48

    Zhang

    JF

    ,

    Kaasik

    K

    ,

    Blackburn

    MR

    ,

    Lee

    CC

    .

    Постоянная темнота — это циркадный метаболический сигнал у млекопитающих

    .

    Природа

    .

    2006

    ;

    439

    :

    340

    343

    .49

    Piccione

    G

    ,

    Marafioti

    S

    ,

    Giannetto

    C

    ,

    Faggio

    C

    ,

    Panzera Фацио

    Ф

    .

    Роль цикла свет / темнота в суточном ритме белков сыворотки крови Equus caballus

    .

    Дж. Апл Биомед

    .

    2012

    ;

    10

    :

    29

    34

    .50

    Houtkooper

    RH

    ,

    Pirinen

    E

    ,

    Auwerx

    J

    .

    Сиртуины как регуляторы метаболизма и продолжительности жизни

    .

    Нат Рев Мол Клетки Биол

    .

    2012

    ;

    13

    :

    225

    238

    .51

    Fulco

    M

    ,

    Schiltz

    RL

    ,

    Iezzi

    S

    и др. .

    Sir2 регулирует дифференциацию скелетных мышц как потенциальный датчик окислительно-восстановительного состояния

    .

    Ячейка Мол

    .

    2003

    ;

    12

    :

    51

    62

    .52

    Эндрюс

    JL

    ,

    Zhang

    X

    ,

    McCarthy

    JJ

    и др. .

    CLOCK и BMAL1 регулируют MyoD и необходимы для поддержания фенотипа и функции скелетных мышц

    .

    Proc Natl Acad Sci USA

    .

    2010

    ;

    107

    :

    19090

    19095

    .53

    Amat

    R

    ,

    Planavila

    A

    ,

    Chen

    SL

    ,

    Иглесиас

    R

    ,

    Giralt

    M Вильярройя

    Ф

    .

    SIRT1 контролирует транскрипцию гена коактиватора-1α рецептора, активируемого пролифератором пероксисом (PGC-1α), в скелетных мышцах через ауторегуляторную петлю PGC-1α и взаимодействие с MyoD

    .

    Дж. Биол. Хим.

    .

    2009

    ;

    284

    :

    21872

    21880

    .54

    Gerhart-Hines

    Z

    ,

    Rodgers

    JT

    ,

    Bare

    O

    и др. .

    Метаболический контроль функции митохондрий мышц и окисления жирных кислот с помощью SIRT1 / PGC-1α

    .

    EMBO J

    .

    2007

    ;

    26

    :

    1913

    1923

    .55

    Liu

    C

    ,

    Li

    SM

    ,

    Liu

    TH

    ,

    Borjigin

    J

    ,

    Lin

    JD

    .

    Коактиватор транскрипции PGC-1a интегрирует часы млекопитающих и энергетический метаболизм

    .

    Природа

    .

    2007

    ;

    447

    :

    477

    481

    .56

    Zhang

    HH

    ,

    Qin

    GJ

    ,

    Li

    XL

    и др..

    Избыточная экспрессия SIRT1 в скелетных мышцах in vivo индуцирует повышенную чувствительность к инсулину и усиление функций комплекса I, но не комплекса II-V в отдельных субарколеммальных и интермиофибриллярных митохондриях

    .

    Дж. Physiol Biochem

    .

    2015

    ;

    71

    :

    177

    190

    .

    Авторские права © 2016 Эндокринологическое общество

    (PDF) Повышенная температура морской воды и свет во время ранней весны ускоряют рост вместилищ Fucus vesiculosus на севере Балтики приливное Балтийское море.Mar Ecol

    Prog Ser 110: 195–201

    Ba

    ¨ck S, Collins JC, Russell G (1991) Аспекты репродуктивной биологии

    Fucus vesiculosus с побережья юго-запада Финляндии.

    Офелия 34: 129–141

    Авторская группа BACC (2008) Оценка изменения климата для

    бассейна Балтийского моря. Региональные климатические исследования. Springer, pp. 1–474

    Барт Д. (2006) Объединение местных экологических знаний и манипуляций с экспериментами для поиска причин изменения окружающей среды.

    Front Ecol Environ 4: 541–546

    Berger R, Malm T., Kautsky L (2001) Две репродуктивные стратегии у

    Baltic Fucus vesiculosus (Phaeophyceae). Eur J Phycol 36: 265–

    273

    Berger R, Henriksson E, Kautsky L, Malm T (2003) Влияние

    нитчатых водорослей и отложений на выживание проростков Fucus

    vesiculosus L. в Балтийском море . Aquat Ecol 37: 1–11

    Berger R, Bergstro

    мкм L, Grane

    ´li E, Kautsky L (2004) Как эвтрофикация

    влияет на разные стадии жизни Fucus vesiculosus в

    Балтийском море? Концептуальная модель.Hydrobiologia 514: 243–

    248

    Breeman AM, Guiry MD (1989) Приливные влияния на фотопериодическую индукцию тетраспорогенеза у Bonnemaisonia hamifera

    (Rhodophyta). Mar Biol 102: 5–14

    Carlson L (1991) Сезонные колебания в росте, воспроизводстве и содержании азота

    Fucus vesiculosus L. в O

    ¨resund,

    Южная Швеция. Bot Mar 34: 447–453

    Coleman MA, Brawley SH (2005) Изменчивость температуры и

    исторические закономерности воспроизводства в комплексе Fucus distichus

    (Heterokontophyta; Phaeophyceae): последствия для видообразования

    и сбора гербария образцы.J Phycol

    41: 1110–1119

    Каннингем EM, Guiry MD, Breeman AM (1993) Environmental

    Регулирование развития, жизненного цикла и биогеографии

    Helminthora stackhousei (Rhodophyta) по продолжительности светового дня и температуре

    . J Exp Mar Biol Ecol 171: 1–21

    Дакос В., Шеффер М., ван Нес Э.Х., Бровкин В., Петухов В., Хельд Н

    (2008) Замедление как сигнал раннего предупреждения о резком изменении климата

    . Proc Natl Acad Sci USA 105: 14308–14312

    ´az E, Kraufvelin P, Erlandsson J (2012) Комбинирование кишечных флюоров —

    метод центрирования и пространственный анализ для определения динамики выпаса литторины

    литореи в обогащенной питательными веществами и питательное вещество —

    необогащенных прибрежных мезокосмов.Mar Biol 159: 837–852

    Гранског М., Каартокаллио Х., Куоса Х., Томас Д. Н., Вайнио Дж. (2006)

    Морской лед в Балтийском море: обзор. Estuar Coast Shelf Sci

    70: 145–160

    Gue

    ´nette S, Heymans SJJ, Christensen V, Trites A (2006) Модели экосистемы

    демонстрируют комбинированные эффекты рыбалки, хищничества, конкуренции и продуктивность океана на морских львах Стеллера (Eumetopias

    jubatus) на Аляске. Can J Fish Aquat Sci 63: 2495–2517

    Harley CDG, Hughes AR, Hultgren KR, Miner BG, Sorte CJB,

    Thornber CS, Rodriguez LF, Tomanek L, Williams SL (2006)

    Воздействие изменения климата в прибрежных морских системах.Ecol

    Lett 9: 228–241

    Hawkins SJ, Sugden HE, Mieszkowska N, Moore PJ, Poloczanska E,

    Leaper R, Herbert RJH, Genner MJ, Moschella PS, Thompson

    RC, Jenkins SR, Southward AJ , Burrows MT (2009) Conse-

    подавление климатических изменений биоразнообразия для функционирования экосистемы

    скалистых берегов Северной Европы. Mar Ecol Prog Ser

    396: 245–259

    Houghton J (2005) Глобальное потепление. Rep Prog Phys 68: 1343–1403

    Hughes L (2000) Биологические последствия глобального потепления: очевиден ли уже сигнал

    ? Тенденции Ecol Evol 15: 56–61

    Isæus M, Rygg B (2005) Расчеты воздействия волн на финском побережье

    .NIVA Rapport LNR 5075-2005, pp 24

    Калвас А., Каутский Л. (1993) Географические изменения морфологии Fucus

    vesiculosus в Балтийском и Северном морях. Eur J

    Phycol 28: 85–91

    Каутский Х., Каутский Л., Каутский Н., Каутский Ю., Линдблад С. (1992)

    Исследования сообщества Fucus vesiculosus в Балтийском море.

    Acta Phytogeogr Suec 78: 33–48

    Киирикки М., Лехво А. (1997) Жизненные стратегии нитчатых водорослей в

    северной части Балтийского моря.Sarsia 82: 259–267

    Kiirikki M, Ruuskanen A (1996) Как Fucus vesiculosus выживает при скребке льда

    ? Bot Mar 39: 133–139

    Korpinen S, Honkanen T, Vesakoski O, Hemmi A, Koivikko R,

    Loponen J, Jormalainen V (2007) Сообщества макроводорослей сталкиваются с

    проблемой изменения биотических взаимодействий: внимательно рассмотрите

    на Балтийском море. Ambio 36: 203–211

    Крауфвелин П. (2007) Реакция на обогащение питательными веществами, волновое воздействие и нарушение

    сообществ на скалистых берегах.Aquat Bot 87: 262–274

    Крауфвелин П., Саловиус С. (2004) Разнообразие животных в скалистой Балтике

    береговые макроводоросли: может ли Cladophora glomerata компенсировать

    потерянных Fucus vesiculosus? Estuar Coast Shelf Sci 61: 369–378

    Крауфвелин П., Мой Ф.И., Кристи Х., Бокн Т.Л. (2006) Добавление питательных веществ

    в экспериментальные сообщества каменистых берегов Повторное посещение: отложенные ответы

    , быстрое восстановление. Экосистемы 9: 1076–1093

    Крауфвелин П., Руусканен А.Т., Наппу Н., Киирикки М. (2007) Зима

    Колонизация и последовательность нитчатых водорослей и возможные связи

    с поселением Fucus vesiculosus в начале лета.

    Estuar Coast Shelf S 72: 665–674

    Kraufvelin P, Lindholm A, Pedersen MF, Kirkerud LA, Bonsdorff E

    (2010) Биомасса, разнообразие и производство каменистых берегов уровни.

    Mar Biol 157: 29–47

    Кулленберг Г., Якобсен Т.С. (1981) Балтийское море: обзор его физической океанографии

    . Mar Pollut Bull 12: 183–186

    Lehvo A, Ba

    ¨ck S, Kiirikki M (2000) Рост Fucus vesiculosus L.

    (Phaeophyta) в северной части Балтийского моря: энергия и хранение азота

    в сезонных условиях. Bot Mar 44: 345–350

    Lenton TM, Held H, Kriegler E, Hall JW, Lucht W, Rahmstorf S,

    Schellnhuber HJ (2008) Опрокидывающие элементы в системе климата Земли

    . Proc Natl Acad Sci USA 105: 1786–1793

    Lindstro

    мкм M (2001) Сезонные изменения подводной световой среды

    в прибрежной зоне Финляндии на Балтийском море.Geophysica 36: 215–232

    Lloret J, Marin A, Mari-Guirao L (2008) Может ли глобальное изменение климата усугубить эвтрофирование катиона

    прибрежной лагуны? Estuar

    Coast Shelf S 78: 403–412

    Lotze HK, Lenihan HS, Bourque BJ, Bradbury RH, Cooke RG, Kay

    MC, Kidwell SM, Kirby MX, Peterson CH, Jackson JBC (2006)

    Истощение , деградация и восстановительный потенциал эстуариев и

    прибрежных морей. Science 312: 1806–1809

    Людер У., Кнотцель Дж., Винке С. (2001) Акклимация тезиса фотосинтеза и пигментов

    к сезонно меняющимся условиям освещения в эндемичной антарктической красной макроводоросле Palmaria decipiens.Pol

    Biol 24: 598–603

    Lu

    ¨ning K, Kadel P (1993) Диапазон продолжительности светового дня для суточной ритмичности

    у Pterygophora californica (Alariaceae, Phaeophyta) и syn-

    хронизация сезонного роста по продолжительности светового дня у нескольких

    других бурых водорослей. Phycologia 32: 379–387

    Machalek KM, Davison IR, Falkowski PG (1996) Термоакклимация и фотоакклимация фотосинтеза у бурых водорослей

    Laminaria saccharina.Растительная клеточная среда 19: 1005–1016

    млн лет назад

    lkki P, Tamsalu R (1985) Физические особенности Балтийского моря. Finn

    Mar Res 252: 1–110

    Miller SM, Wing SR, Hurd CL (2006) Фотоакклимация Ecklonia

    radiata (Laminariales, Heterokontophyta) в Doubtful Sound,

    Fjordland, южная часть Новой Зеландии. Phycologia 45: 44–52

    1806 Mar Biol (2012) 159: 1795–1807

    123

    Lada 4×4 Urban Review: Да, товарищ, Да

    Примечание редактора: Нет, вы не можете купить Lada в США.Но у наших коллег из Motor1.com в Германии была возможность прокатиться на этом интересном внедорожнике, и мы не могли не поделиться ею с вами. Наслаждайтесь этой первой поездкой от команды Motor1.com Germany .

    Что это?

    Это Lada 4×4, автомобиль, который можно продать в одном из тех магазинов, где жители большого города покупают копии телефонов 1950-х годов и китайские выключатели для своих модных квартир в старом городе. Это средство передвижения для людей, которые говорят: «Они все еще существуют, старые добрые вещи.«С конца 2017 года эта старая добрая русская вещь доступна и в пятидверном исполнении. Мы тестировали XL-Lada.

    В Советской России вас водит «Лада»:

    Легенда бездорожья родилась как «Нива» в 1976 году и была спроектирована так, чтобы быть сильной, как медведь — стойкость и способность были необходимы, чтобы добраться до самых глубин обширной советской империи. Но с 1995 года «Нива» строится как пятидверная, в Тольятти, Детройте, Россия (но с еще более холодной зимой). В конце 2000-х он окончательно лишился названия «Нива» и теперь известен просто как 4х4.

    Что нового?

    Зачем большое переименование? В названии внедорожника воплощена суть бывшей «Нивы»: полный привод. Пересеченной местности. Грязь. Снег. Никаких уловок, чистая техника. Но даже сильные российские 40-летние, такие как внедорожники, подвержены кризису среднего возраста, поэтому у 4×4 теперь есть новая отделка под названием «Городской». Как будто за 40 в обтягивающих джинсах.

    4×4 Urban получает электрически регулируемые наружные зеркала с подогревом, 16-дюймовые алюминиевые колеса и переднее сиденье с подогревом.И что еще важнее (или того хуже, смотря по ракурсу): крашеные пластиковые бамперы.

    В дополнение к травмам наш тестер 4×4 Urban имеет яркий оттенок синего металлик, который, мы уверены, товарищ Брежнев не одобрил бы, если бы он был выпущен с завода в 1976 году. Результатом этих изменений и окраски стал Лада, которая выглядит незнакомой. Тем не менее, он немногим больше Hyundai Kona. Пятидверный 4×4 имеет длину 162,4 дюйма, что на 19 больше, чем традиционный трехдверный 4×4.6 дюймов. Эта разница полностью связана с осями, поскольку колесная база увеличивается с 86,6 до 106,2 дюйма.

    Эти 19,6 дюйма окупаются во втором ряду, что удобнее, чем в более коротком 4×4. Доступ лучше благодаря задним дверям, а объем багажника начинается с 15,5 кубических футов, но увеличивается до 27,5 при сложенном втором ряду, оставляя достаточно места для дров, мертвых животных или других поворотных телефонов 1950-х годов.

    Как ездит?

    Еще одним преимуществом более длинной колесной базы является значительное повышение комфорта езды.Пятидверный 4х4 явно лучше в повседневной езде, чем его младший брат. Но увеличенный размер означает увеличение веса — около 280 фунтов. При весе 3141 фунт 4×4 Urban бросает вызов атмосферному 1,7-литровому бензиновому двигателю.

    Звук гудения, болтовни и жужжания делает крошечную четверку сильнее, чем она есть на самом деле. У него всего 83 лошадиных силы и 95 фунт-фут крутящего момента — пятидверному полноприводному автомобилю требуется 19 секунд, чтобы разогнаться до 62 миль в час, а максимальная скорость — 85 миль в час.Это явно средство для людей с терпением Будды и поклонников классических автомобилей, которые могут оценить расслабленный темп и длинные броски упрямого ручного переключателя передач.

    Это даже не особенно экономно, возвращая 24,7 миль на галлон в европейском цикле испытаний, число, которое может упасть до 19,6 миль на галлон в городе — хотя он соответствует стандарту Euro 6, так что по крайней мере он чистый. Тем не менее, Lada действительно придерживается традиций, с постоянным полным приводом, коробкой передач с низким диапазоном и блокировкой дифференциалов.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *