Габаритные размеры акрос 580: Зерноуборочный комбайн Акрос 580 Ростсельмаш

Содержание

Перевезти комбайн ACROS 585, ACROS 595, ACROS 530, CLAAS 580, CLAAS 670, CLAAS 760

За годы работы организации Тоэндо Карго сформировался определенный положительный опыт в перевозках комбайнов. Одними из самых популярных моделей для перевозки комбайнов в нашей организации являются  ACROS 585, ACROS 595, ACROS 530, CLAAS 580, CLAAS 670, CLAAS 760.

Как правило, габариты указанных комбайнов существенны и по высоте и по ширине, а такая перевозка попадает под понятие перевозки негабаритных грузов. При выполнении такой перевозки необходимо использовать низкорамный трал и изготавливать разрешение на негабаритную перевозку.

Виды тралов для перевозки комбайнов

Для транспортировки комбайнов мы используем разные виды тралов, исходя из габаритов каждой модели. Это могут быть тралы и с передним заездом и тралы с заднем заездом или без заезда.

Тралы с переднем заездом мы используем, если планируется перевозка без демонтажа колес, в таком случае высота не должна быт более 4,49 метров.

В случаях, если

то мы используем более экономичные тралы, погрузочной высотой 0,9 метров. При этом погрузка на трал будет производиться краном, а колеса будут демонтированы с комбайна.

Также, можно использовать тралы с задним заездом и демонтировать колеса уже на трале.

В фотогалерее можно ознакомиться с размещением комбайна на трале со снятыми колесами.

 

Перевозка комбайна путем демонтажа колес и жатки

Чаще всего модели комбайнов ACROS 585, ACROS 595, ACROS 530, CLAAS 580, CLAAS 670,

CLAAS 760 и другие перевозятся в разобранном состоянии со снятыми колесами.

Колеса и жатка обычно укладываются ближе к тягачу на гусек, далее грузится сам комбайн. Длина автопоезда в таком состоянии не должна превышать 24 метра, ширина не более 3,5 метров, а высота не более 4,49 метров. Таким образом, мы оптимизируем стоимость перевозки за счет уменьшения высоты и ширины комбайна.

 

ФОТОГАЛЕРЕЯ: Фото: Перевозка комбайнов (СтройкаЛипецк)

Заказать перевозку комбайна или получить консультацию по перевозке комбайна

можно по телефонам и по  +7 (499) 499-19-17, +7 (496) 532-64-83 или отправляйте сообщение на электронную почту [email protected] или [email protected]

Блок радиаторов на комбайн ACROS-580: БО-173.1301.000

 

купить радиатор К-700, радиатор +К-744, ДЗ-98 радиатор 238.1301.100, К-700 4-рядный радиатор,,

 

Блок радиаторов Акрос: БО-173.1301.000
Применяемость: комбаны ACROS-580/590 (585/595) двигатель Cummins

Техническая характеристика блока:
Исполнение: медно-латунный,традиционная технология
В составе блока 3 секции: водяная, масляная и охладитель
— водяная: — БО-173. 1301.100
— охладитель: — БО-173.1317.200
— масляная: — БО-173.1013.300 (выход патрубков с одной стороны)
Габаритные размеры,мм: высота- 1090  ширина- 1044  толщина- 219
Вес,кг: —
Упаковка: обрешетка
Производитель: ООО«Оренбургский радиатор»
блок радиаторов БО-173.1301.000 аналогичен
— БО173Б.1301.000 в алюминиевом исполнении ООО «Оренбургский радиатор»
! техническая особеность алюминиевого блока
в алюминиевом блоке на масляной секции выход патрубков с разных строн

Отгрузим транспортной компанией: [email protected]

* Цена не является публичной офертой, технические характеристики носят информационный характер.
  Мнения и рекомендации отражают только нашу точку зрения и не являются официальными.

БО-173. 1301.000 блок радиаторов комбайна ACROS-580
медно-латунный,трубчато-пластинчатый,традиционная технология
— чертеж блока радиаторов ACROS-580

Блок радиаторов ACROS-580, блок радиаторов комбайна ACROS-580: [email protected]
Оренбургский радиатор,Шадринский автоагрегатный завод, Бузулукский механический завод

ACROS 580 530 | tc-opolie

ACROS 580  530

 

Высокопроизводительные машины с традиционной схемой обмолота для уборки любой культуры

 

Новый стандарт эффективности

Производством зерна занимается множество хозяйств. При выборе техники, в том числе зерноуборочных комбайнов, руководитель каждого хозяйства следует своим принципам. Кто-то ориентируется на громкие имена производителей. Кого-то привлекают сверхсовременные, модные технологии. Кому-то кажется, что внушительная стоимость и рекордная производительность машин будет гарантировать успешную работу. Такие хозяйства есть, но зерноуборочные комбайны Ростсельмаш — не для них.

Комбайны Ростсельмаш выбирают те, кому важен, прежде всего, финансовый результат, кто ищет и находит оптимальные решения во всем, в том числе в вопросе выбора техники. Те, для которых производство зерна — прибыльный бизнес, а не «битва за урожай» любой ценой. Комбайны Ростсельмаш — для Профессионалов Агробизнеса.

Представляем комбайны ACROS 530 и 580 — новое поколение высокопроизводительных зерноуборочных комбайнов Ростсельмаш.

 

1. Успешное начало

Комбайны ACROS оснащаются жатками серии Power Stream шириной захвата 6, 7 и 9 м. Практика подтверждает, что применение этих жаток сокращает потери зерна из-за осыпания и обеспечивает равномерную подачу вне зависимости от условий работы. Power Stream создает основу для максимальной производительности ACROS.

 

Качественный срез

Планетарный привод ножей: высокая частота резания, точность хода и малый износ.

Планетарный привод ножей типа Schumacher работает плавно, точно и без износа. Высокая частота резания (1080 ходов/мин) и двойная режущая кромка гарантируют быстрый и чистый срез при минимальных потерях. Снижению потерь на жатке способствует и значительное (0,75 м) расстояние от ножей до шнека.

 

Плавная подача

Гидропривод мотовила: плавное, мощное и практически бесшумное вращение мотовила.

Гидропривод мотовила позволяет бесступенчато регулировать скорость его вращения, обеспечивая оптимальную и равномерную подачу массы для повышенной производительности.

 

Надежная работа в самых тяжелых условиях

Комбайны ACROS оснащаются жатками серии Power Stream шириной захвата 6, 7 и 9 м. Практика подтверждает, что применение этих жаток сокращает потери зерна из-за осыпания и обеспечивает равномерную подачу вне зависимости от условий работы. Power Stream создает основу для максимальной производительности ACROS.

Длинные пальцы граблин и мотовило с особой траекторией движения легко справляются со скрученными и полеглыми хлебами. Большой диаметр шнека предотвращает наматывание высокостебельных хлебов. Глубокие витки шнека исключают потребность в дополнительных пальцах.

 

Точное копирование рельефа

Комбайны ACROS оснащаются жатками серии Power Stream шириной захвата 6, 7 и 9 м. Практика подтверждает, что применение этих жаток сокращает потери зерна из-за осыпания и обеспечивает равномерную подачу вне зависимости от условий работы. Power Stream создает основу для максимальной производительности ACROS.

Возможность продольно-поперечного копирования рельефа почвы — это эффективное использование всей длины жатки на неровных полях. Все жатки Power Stream стандартно оснащаются простым и надежным гидромеханическим устройством копирования Level Glide, по заказу — электрогидравлической системой Auto Contour.

Транспортная тележка поможет быстро и удобно добраться до места работы.

 

Мощный реверс

Гидравлический реверс рабочих органов жатки и наклонной камеры, включаемый из кабины, поможет быстро очистить жатвенную часть при забивании хлебной массой или попадании посторонних предметов.

 

2. Максимальная продуктивность

Для ACROS Ростсельмаш создал оригинальную, высокоэффективную систему обмолота. Крепкую и надежную, с высокой пропускной способностью и бережной сепарацией, отвечающей самым высоким требованиям к качеству зерна.

 

Супербарабан

Ее главная особенность — оригинальный молотильный барабан самого большого диаметра в мире (800 мм), который благодаря огромной инерционности легко справляется с влажной, засоренной или скрученной хлебной массой.

 

Высоконадежный привод

Привод молотильного барабана разработан для максимальных нагрузок и имеет устройство типа Posi-Torque для автоматического натяжения ремня при увеличении крутящего момента. Это дает заметную прибавку в производительности комбайна. Частота вращения барабана (400…1045 об/мин) регулируется из кабины, посредством вариатора.

Камнеуловитель предотвращает попадание камней в молотилку. Благодаря особой конструкции, его очистка занимает не более минуты.

При обмолоте культур, зерна которых легко повреждаются, необходимо работать на низких оборотах барабана. Для этого предлагается компактный редуктор, понижающий частоту вращения до 200-450 об/мин (для ACROS 530 — дополнительное оборудование).

95% сепарации

Отличный доступ к молотильному барабану открывается через два больших боковых люка.

Большой диаметр барабана позволил максимально увеличить угол охвата подбарабанья (130°), обеспечив значительную площадь сепарации (1,38 кв.м) и наиболее выгодную геометрию обмолота — протяженную и плавную. Этим достигается почти полная (95%) сепарация с исключительно низким повреждением зерна. Не каждая многобарабанная система показывает такие результаты!

 

Точная настройка

Забивание, если оно все же произошло, можно быстро устранить с помощью Jam Control – устройства глубокого сброса деки. В отличии от комбайнов с системой реверса барабана, эта операция занимает считанные секунды.

 

3. С полной отдачей

Соломистая масса, содержащая на выходе из молотильного барабана часть зерен, направляется отбойным битером на соломотряс. С выделением остаточного зерна 5-ти клавишный семикаскадный соломотряс ACROS справляется без проблем.

Свободное зерно и мелкие соломистые частицы проходят через жалюзи соломотряса и поступают в систему очистки, а длинносоломистая масса быстро транспортируется к выходу из молотилки.

 

Большая поверхность соломотряса, выверенный перепад высот между его каскадами и оптимальный кинематический режим работы гарантируют максимальную сепарацию.

Чтобы оценить правильность настройки системы обмолота, предусмотрены датчики потерь зерна, устанавливаемые на клавишах соломотряса. Они сигнализируют через автоматическую систему контроля о степени содержания зерна в соломе, и необходимости изменения режимов обмолота.

 

Гибкая работа с соломой

Толщина ножей, увеличенная в сравнении со стандартными почти в 1,5 раза, позволяет измельчать грубые стебли кукурузы и подсолнечника, не прибегая к регулировке противорежущего устройства.

Классическая система обмолота и сепарации ACROS практически не повреждает солому. В зависимости от предполагаемого использования, солому можно измельчить и разбросать или уложить в валок.

Встроенный измельчитель-разбрасыватель обеспечит тщательную резку соломы и равномерное распределение по поверхности поля на заданную ширину в качестве удобрения. В конструкции используется 64 обоюдоострых ножа с износостойкими кромками, обладающими эффектом самозаточки. Включение измельчителя производится кнопкой из кабины.

Одно движение – и измельчитель переведен в режим укладки валка.

 

4. Чистый результат

Зерновой ворох, поступающий с подбарабанья и соломотряса, проходит двухступенчатую систему очистки. Верхнее и нижнее решета подвешены на рычагах с противоположным ходом и разными амплитудами с целью взаимного уравновешивания сил инерции и более равномерного распределения зерна. Отдельные настройки решет помогают точно и быстро адаптироваться к различным условиям уборки.

 

Мощная продувка воздухом

Шестилопастной вентилятор создает плотный поток воздуха, продувающий все участки системы очистки. Скорость вращения вентилятора плавно регулируется из кабины и отображается на панели управления. Расширенный вниз диапазон скоростей позволяет снизить потери при работе с мелкосеменными культурами, а также удобен для удаления легких отходов.

 

Меньше времени на разгрузку

Запатентованное «волновое» решето: разные размеры гребенок верхнего решета обеспечивают равномерное распределение воздушного потока.

Как показывает практика, на выгрузку зерна тратится около 5% рабочей смены. Для сокращения этого времени ACROS оборудован зерновым бункером внушительного объема (9000 л) и высокопроизводительным выгрузным элеватором (90 л/с).

Взять пробу зерна из бункера можно прямо с площадки кабины.

Высота, длина и угол поворота выгрузного шнека рассчитаны на беспрепятственную выгрузку в любой грузовой транспорт, даже если это длинный прицеп, а комбайн оборудован жаткой шириной 9,0 м.

 

Выгрузка влажного зерна

Взять пробу зерна из бункера можно прямо с площадки кабины.

Особое внимание уделено стабильной работе выгрузного устройства в условиях высокой влажности. Уникальное запатентованное устройство Smart Launch надежно защищает высокоскоростной механизм от перегрузки, а гидропульсаторы исключают «зависание» зерна в бункере


5. Готовность к любым задачам

На комбайны ACROS устанавливаются надежные 6-цилиндровые двигатели ЯМЗ и Cummins, тщательно подобранные по мощности и крутящему моменту. 20% запас мощности гарантирует, что в любой уборочной ситуации зерноуборочный комбайн ACROS будет исправно выполнять свою работу.

 

Много не просит

Минимальные затраты на горючее — это еще одно условие высокоэффективной уборки, которое учитывалось при выборе двигателей для ACROS. Благодаря применению компактных силовых агрегатов с турбонаддувом, удельный расход топлива снижен как минимум на 5%. Экономичный двигатель вместе с 540-литровым топливным баком позволяют работать без дозаправки до 14 часов.

 

Симметричный привод

Моторный отсек предоставляет достаточно свободного места для ведения работ по техобслуживанию двигателя и радиатора.

Кинематические передачи ACROS разработаны таким образом, что мощность равномерно распределяется на обе стороны машины, практически симметрично.

Силовые контуры не пересекаются, на одном валу — не более 2-х потребителей энергии. Каждая ременная передача имеет индивидуальную регулировку. Это лучшая конструкция для быстрой и оптимальной настройки.

 

Полный вперед!

Для сокращения времени обслуживания воздухозаборник блока радиаторов имеет встроенный очиститель.

Привод ходовой части ACROS отличается впечатляющей тяговой силой, достаточной для уверенной работы комбайна в самых разнообразных условиях.

4-х диапазонная коробка передач обеспечивает оптимальный тяговый момент в любом диапазоне скоростей.

Гидростатическая трансмиссия обеспечивает бесступенчатую регулировку скорости движения в пределах любой из 4-х передач. Расширенный диапазон рабочих скоростей (до 15 км/ч) поможет полностью загрузить молотилку при работе на низкоурожайных полях. Благодаря высокой транспортной скорости (до 27 км/ч) экономится время перегона комбайна к месту работы.

 

6. Удобство в работе

Комбайны ACROS оснащаются кабиной Comfort Cab. Находясь в ней, Вы поймете каким удобным может быть рабочее место. Вы будете наслаждаться комфортом, который действительно помогает работать эффективно, с меньшим напряжением и усталостью.

 

Отличный обзор

Кондиционер, холодильная камера и магнитола с акустической системой входят в стандартную комплектацию Comfort Cab.

Большая площадь остекления (5 кв. м) Comfort Cab и панорамная форма стекол гарантируют беспрепятственный обзор во все стороны. Вы отлично видите поле, стерню за жаткой и выгрузной шнек.

Рулевая колонка регулируется по высоте и углу наклона.

В задней стене кабины имеется большое окно — для наблюдения за бункером. При работе ночью полное освещение рабочей зоны обеспечивают мощные галогенные фары.

 

Рабочая атмосфера

Для обслуживания кондиционера и воздушного фильтра достаточно поднять откидную секцию крыши.

Comfort Cab смонтирована на четырех амортизаторах, чтобы быть максимально изолированной от вибрации. Детали интерьера благодаря многослойной структуре обладают свойствами звукопоглощения.

В результате уровень шума в кабине снижен до рекордных 74 дБ и почти полностью отсутствуют вибрации. С помощью системы кондиционирования, отопления и вентиляции Вы сможете создать в кабине здоровый и приятный микроклимат.

 

Устраивайтесь поудобнее

Галогенные фары светят в два раза ярче, чем обычные. 8х70 Вт — с таким мощным освещением можно продолжить работу и ночью.

Рабочее место оборудовано подрессоренным креслом и рулевой колонкой со всеми необходимыми регулировками, которые позволят Вам без труда подобрать удобное рабочее положение. Для Вашего помощника или ученика имеется мягкое откидное сиденье

 

7. Все под контролем

Эргономика Comfort Cab тщательно проработана. Все элементы управления находятся на «своих» местах, приборы — в зоне прямого зрения. С первых часов работы Вы почувствуете это и сможете без особых усилий поддерживать напряженный темп уборки.

 

Одной рукой

Рукоятка многофункционального манипулятора спроектирована на естественный захват ладонью и идеально лежит в руке.

На рукоятке гидростата собраны элементы управления всеми функциями комбайна, требующими быстрого реагирования: движение вперед/назад, регулировка положения жатки и мотовила, скорости вращения мотовила, включение и отключение приводов жатки.

 

Интеллектуальная панель

Для обслуживания кондиционера и воздушного фильтра достаточно поднять откидную секцию крыши.

Органы управления, которые используются реже, расположены правее от кресла, на компактной панели. Легким нажатием на псевдосенсорные кнопки Вы сможете управлять всеми рабочими органами комбайна, как в ручном, так и в автоматическом режимах. Кроме того, панель производит диагностику целостности электроцепей и контролирует исполнение команд.

Для удобства и легкости освоения каждая кнопка имеет понятное обозначение и выполняет только одну функцию. Псевдосенсорные кнопки, в отличии от традиционных, полностью защищены от пыли, значительно надежнее и долговечнее.

 

Чуткий помощник

Для обслуживания кондиционера и воздушного фильтра достаточно поднять откидную секцию крыши.

Под Вашим контролем находится большое количество параметров. Но физиологически человек способен держать во внимании не более 5 параметров. Поэтому для Вас предусмотрен Adviser — автоматизированная система контроля, непрерывно следящая за процессом обмолота и работой механизмов комбайна.

Для обслуживания кондиционера и воздушного фильтра достаточно поднять откидную секцию крыши.

Принцип вывода информации на экран Adviser избавляет Вас от необходимости лишний раз погружаться в подпункты сложного меню — все необходимые для контроля параметры появляются автоматически, в зависимости от ситуации.

Еще одно уникальное свойство системы — голосовое оповещение. Теперь Вы можете спокойно работать, не отрывая взгляда от рабочей зоны. В случае возникновения отказа или критических режимов, Вы услышите соответствующее сообщение, краткий комментарий и рекомендации по дальнейшим действиям.

 

8. Скрытые резервы

Вам нужен не просто комбайн, а обеспечивающая полную отдачу машина, приспособленная под Ваши конкретные задачи. Комбайн ACROS — именно такая машина. Благодаря широкому выбору адаптеров и дополнительных приспособлений ACROS способен выполнять самую разнообразную работу на протяжении всего сезона.

 

Подбор валков

При раздельной уборке ACROS оборудуется платформой-подборщиком. Как и жатка, это приспособление способно копировать рельеф поля в продольном и поперечном направлениях.

Надежная защита элементов подборщика от забивания, наматывания и сдувания массы ветром обеспечивает его устойчивую работу даже в неблагоприятных условиях.

 

Подсолнечник

Специально разработанная для ACROS 8-рядковая жатка обеспечит полноту сбора урожая не менее 98%, что недостижимо при использовании приспособлений других типов. Жатка надежно работает на любом агрофоне, включая низкорослые гибриды подсолнечника.

 

Кукуруза

Для уборки кукурузы на зерно ACROS оборудуется 6- или 8-рядковым початкоотделителем. Дополнительное оборудование, например, массивная решетка на первый каскад соломотряса, поможет продлить срок службы машины в тяжелых условиях уборки данной культуры.

 

Рапс

Специальная приставка позволит сократить потери семенников рапса при скашивании в 3…4 раза и дополнительно собирать, в зависимости от урожайности, 30-100 кг зерна с 1 га посевов.

Семенники трав, крупяные

Для достижения максимальной эффективности при уборке крупяных и других легко травмируемых культур предлагается дополнительное оборудование. К примеру, комплект перфорированных решет поможет улучшить воздушный режим очистки, а набор для домолачивающего устройства делает его работу более деликатной.

Ямазенуса | EPCLC AI-580S ДЕТАЛЬ

Удобное программное обеспечение с широкими функциями и возможностями

Нажмите , чтобы увеличить изображение

Оптимальные параметры расхода, времени анализа, объема фракции и т.

д. будут рассчитываться и устанавливаться автоматически при выборе столбца в программном обеспечении Yamazen «Green Flash». Параметры по умолчанию будут показаны в окне настройки системы.

Программное обеспечение Yamazen предоставляет информацию о максимальной загрузке образца для выбранной колонки

Выберите столбец, нажмите кнопку [Загрузка образца], введите значения Rf ТСХ целевого соединения и ближайшей примеси, и максимальная загрузка образца будет рассчитана и задана автоматически. Если выбран другой столбец, максимальная загрузка образца изменится соответствующим образом. Это будет отличным руководством для вас, чтобы выбрать правильную колонку для запуска вашего образца.

Современное программное обеспечение, основанное на истинной теории хроматографии

Yamazen — единственная компания, которая успешно перенесла метод с ТСХ на колоночную хроматографию, основанную на истинной теории хроматографии.

Зеленая флэш-хроматография
     Линейный градиент установлен со значением Rf на TLC. (радиочастотный градиент)
     Оптимальный метод может быть автоматически разработан для элюирования целевого соединения при объеме около 4 колонок.
     Позиция элюирования целевого соединения (соединений) показана желтой стрелкой (стрелками).

Нажмите , чтобы увеличить изображение

Для систем флэш-хроматографии Yamazen можно полностью контролировать положение элюирования образца

и разрешение.

(Патент № 4087395)

2-Step Gradient эффективно разделяет несколько соединений.

2-ступенчатый градиент лучше всего подходит для разделения двух целевых соединений, у которых значения Rf по ТСХ (Rf1&Rf2/(3)&(6)) сильно отличаются друг от друга (ΔRf>0,3), а некоторые другие соединения находятся между ними. . Как показано на рис. 1, двухступенчатый градиент эффективно очищает несколько соединений, достигая высокого разрешения. И Rf1 (Соединение 3) и Rf2 (Соединение 6) элюируют при объеме от 4 до 5 колонок при каждом градиенте.

По сравнению с обычным ИЗОКРАТИЧЕСКИМ методом двухэтапный градиентный метод значительно сокращает время работы, экономит растворители и энергию и повышает производительность, поэтому он является экологически безопасным.

Автоматическая настройка метода для обращенно-фазовой хроматографии

Сначала выполняется предварительный анализ небольшого количества образца, поскольку нет корреляции между ТСХ и колоночной хроматографией. По окончании предварительного прогона щелкните пик целевого соединения. Оптимальный градиентный метод для реального цикла будет разработан автоматически, как и для нормально-фазовой хроматографии.

Возможна автоматическая настройка метода с различными растворителями, например, гексан/толуол.

(Дополнительную информацию см. в техническом бюллетене Yamazen № 61.)

При использовании инъекционной (загрузочной) колонки загрузку образца можно легко выполнить без потери образца. Отсутствие перекрестного загрязнения.

Преимущество использования инжекторной колонки для загрузки проб (1)

Inject Column сужает полосы проб для достижения более высокого разрешения. Кроме того, образец большего размера может быть разделен колонкой небольшого размера с использованием колонки ввода.

Преимущество использования инжекторной колонки для загрузки проб (2)

Метод достижения хорошего разделения пробы, растворенной в высокополярном растворителе

Нет «Коэлюта»!

Высокополярный растворитель, используемый для растворения образца, часто приводит к плохому разделению образца при флэш-хроматографии.

Поэтому для растворения образца рекомендуется использовать слабополярный растворитель.Однако во многих случаях необходимо использовать высокополярный растворитель при растворении труднорастворимого образца. Инжекторная колонка Yamazen устраняет вредное воздействие высокополярного растворителя, используемого для растворения образца, путем улавливания высокополярного растворителя. Используя инжекторную колонку вместе с основной разделительной колонкой, например, универсальной колонкой, колонкой Hi-Flash и т. д., доступными от Yamazen, можно добиться хорошего разделения проб.

Новое инновационное программное обеспечение для определения рекомендуемого размера инъекционной колонки, которое устраняет вредное влияние на хроматографию высокополярного растворителя, используемого для растворения образца (….скоро будет в наличии.)

Введите название растворителя и количество растворителя, используемого для растворения образца, а также рекомендуемый размер колонки для ввода, которая устраняет вредное воздействие высокополярного растворителя, используемого для растворения образца, будет определено автоматически и появится во всплывающем окне. окно.

Широкий диапазон обнаружения УФ-детектора Yamazen


Отсутствие потерь образца! Нет пиковой насыщенности!

Возможность обнаружения в широком диапазоне критически важна для флэш-хроматографии!

При работе с образцом небольшого размера или образцом с низким УФ-поглощением:

УФ-детектор

Yamazen способен обнаруживать образец с очень высокой чувствительностью.Как показывают приведенные ниже хроматограммы, эти образцы точно обнаруживаются и прекрасно разделяются при 0,08 AUFS и 0,04 AUFS на УФ-детекторе Yamazen. Обычные УФ-детекторы других производителей, однако, не обладают достаточной чувствительностью, что приводит к потере ценных образцов.

Образец: Бутил-п-гидроксибензоат, 0,5 мг Метил-п-гидроксибензоат, 0,5 мг Толуол, 9 мг
Используемая колонка: Yamazen’s Hi-Flash, L (30 г) Режим фракционирования: разделение в пиковом режиме

При работе с крупномасштабным образцом или образцом с высоким УФ-поглощением:

Образец: бутил-п-гидроксибензоат, 500 мг метил-п-гидроксибензоат, 500 мг толуола, 900 мг
Используемая колонка: Yamazen’s Hi-Flash, 2 л (45 грамм)   Режим фракционирования: разделение в пиковом режиме

Можно получить медленный градиент от 1% до 7% полярного растворителя.

Насос для подачи растворителя представляет собой высокоточный бесклапанный керамический поршневой насос среднего давления с плавной регулировкой расхода. Возможен градиент при низкой концентрации растворителя от 1 до 7%, что требуется при использовании высокополярного растворителя, такого как метанол, без предварительного смешивания.

Эффективное движение керамического поршня для максимального удаления растворителя и пузырьков, гарантируя точную подачу растворителя. Пузырьки, образованные растворителями с низкой температурой кипения, такими как дихлорметан, не повлияют на работу насоса.

Монитор давления в режиме реального времени

Прецизионный датчик давления позволяет в режиме реального времени отслеживать повышение давления внутри колонны. Когда давление достигает заданного предела, насос мгновенно останавливается, что защищает систему от повреждения. Быстродействующая система ограничения давления (PMS) предотвращает разрыв одноразовых пластиковых и стеклянных колонок и позволяет продолжить анализ пробы.

Девиз Ямазена: «Безопасность превыше всего!»

Параллельное обнаружение УФ-детектора и детектора рефракции или ELSD

Детектор

Yamazen RI-31 RI и испарительный светорассеивающий детектор ELSD-100X предназначены для использования с системами очистки «Smart Flash» для очистки органических соединений с небольшим содержанием хромофоров или без них, таких как углеводы, стероиды, липиды, терпены и другие соединения, содержащие отсутствие поглощения ультрафиолета.Параллельное обнаружение между УФ-детектором и детектором RI или ELSD возможно с помощью системы флэш-хроматографии Yamazen.

Технические характеристики системы


Насос подачи растворителя
Модель № № 580S
Расход 0-80мл/мин.
Номинальное давление 1.0 МПа (145 фунтов на кв. дюйм)
Количество смешанного растворителя 2 (выберите один из 4 растворителей)
Размеры 140Шx350Гx280В (мм)
Масса 10 кг
УФ-детектор с фиксированной длиной волны
Модель № препУФ-254
Источник света Лампа ртутная
Длина волны 254 нм
Диапазон детектора 0,08-5,12 АУФС
Размеры 140Шx350Гx135В (мм)
Масса 5 кг
УФ-детектор с переменной длиной волны
Модель № prepUV-10VH (одна длина волны)
prepUV-20VH (две длины волны)
Источник света Лампа D2
Длина волны 200–400 нм
Диапазон детектора 0,02-10,24 АУФС
Размеры 140Шx350Гx185В (мм)
Масса 4.5 кг
УФ-видимый детектор с переменной длиной волны
Модель № prepUV/VIS-10VH (одна длина волны)
prepUV/VIS-20VH (две длины волны)
Источник света Лампа D2 и галогенная лампа
Длина волны 200–800 нм
Диапазон детектора 0.02-10.24 АУФС
Размеры 140Шx350Гx185В (мм)
Масса 4,5 кг
Коллектор фракций
Модель № ФР-360
№стойки 2 (пара стоек одного размера)
Режим движения с приводом по осям X-Y
Дробный режим Время, пик, пик и наклон (долина), ручной сбор
Входной сигнал Сигнал специального назначения
Размеры 320Шx438Гx522В (мм)
Масса 16 кг
Системный контроллер (встроенный в коллектор фракций)
Входной/выходной сигнал Насос, детектор, коллектор фракций, специальный ПК
Рекомендуется
Характеристики ПК
ОС Windows XP, 7 (32-разрядная)
ЦП Pentium III или Mobile Celeron с тактовой частотой 500 МГц или более или Atom D410.
Память 1 ГБ или более
Монитор Рекомендуется разрешение XGA или выше
Место на жестком диске Не менее 150 ГБ доступной памяти
Входной/выходной сигнал Последовательный порт RS232C D-sub 9 контактов или USB
* Для получения дополнительных характеристик ПК, пожалуйста, обращайтесь.
Стандартные принадлежности
Пара стеллажей одного размера

Стеллаж FR-360
118Шx335Дx159ммВ

Примечание. Коллектор фракций FR-360 вмещает пару стеллажей одинакового размера.
При заказе стойки указывайте Кат. Количество.

Спецификации штатива, пробирка для сбора (наружный диаметр x длина x количество)

Кат. №

Пин-код

Дробный объем (по умолчанию)

Размер трубки американского стандарта (мм)

АИ13100

А

7 мл

13x100x75 шт.

АИ15125

А

12 мл

15x125x75 шт.

АИ16125

А

15 мл

16x125x75 шт.

АИ16150

А

16 мл

16x150x75 штук

АИ18150

Б

22 мл

18x150x75 штук

АИ25150

С

45 мл

25x150x30 штук

АИ25200

С

56 мл

25x200x30 штук

АИ30200

Д

100 мл

*30x200x27 шт.

АИ60180

Е

350 мл

*60x180x10 шт.

Примечание. Пробирка со знаком * соответствует японскому стандарту.

Кат. №

Пин-код

Дробный объем (по умолчанию)

Размер трубы японского стандарта (мм)

АИ15150

А

15 мл

15x150x75 штук

АИ18180

Б

30 мл

18x180x75 шт.

АИ24180

С

60 мл

24x180x75 шт.

АИ30180

Д

90 мл

30x180x27 шт.

АИ30200

Д

100 мл

30x200x27 штук

АИ16180

Е

350 мл

60x180x10 шт.


Фитинги и трубки

Опции
Монитор уровня растворителя
Монитор отработанной жидкости
Насос продувки воздуха колонки
Устройство считывания изображений ТСХ

загрузить брошюру (PDF) Серия EPCLC AI-58

Ямазенуса | ИНЖЕКЦИОННЫЕ КОЛОННЫ

Рекомендуется

ИНЖЕКЦИОННЫЕ КОЛОНКИ

Колонки для загрузки проб

Колонки
Inject используются исключительно для загрузки проб и используются с колонками для основного разделения, такими как колонки Universal, колонки Hi-Flash, колонки Ultra Pack и т. д.
Колонки
Injection помогают разделять плотные соединения и предотвращают уширение пиков при использовании полярных растворителей, что приводит к образованию острых пиков.

Мы рекомендуем использовать колонку Inject вместе с основной разделительной колонкой, такой как колонка Universal, колонка Hi-Flash и т. д., для лучшей очистки пробы.

Инжекторная колонка с набивкой

Для использования требуются адаптер колонки, держатель колонки и инъекционное соединение

Пустая колонка ввода

Для использования требуются адаптер колонки, держатель колонки, инъекционное соединение и тефлоновый фильтр

Размер колонки И.D. x Длина в упаковке (мм) Общая длина (мм)
10 х 30 60
13 х 31 60
С 15 х 44 85
М 20 х 75 95
Л 26 х 80 135
26 х 150 180
46 х 130 160
4 л 48 х 170 200
60 х 180 210
Инъекционная колонка с силикагелем

Номер продукта

Размер колонки

Для использования с

Количество оплачиваемой пробы (мл)

Весы для заказа (шт.)

W829-02
W829-05
W829-10

Колонка High-Flash, универсальная колонка S
, колонка S
Ultra Pack A

1.5

20
50
100

W825-02
W825-05
W825-10

Колонка High-Flash, S, M
Универсальная колонка, S, M
Колонка Ultra Pack A

3

20
50
100

W826-02
W826-05
W826-10

С

Колонка Hi-Flash, M, L, 2 л
Универсальная колонка, M, L
Колонка Ultra Pack B

5

20
50
100

W827-02
W827-05
W827-10

М

Колонка Hi-Flash, л, 2 л, 3 л
Универсальная колонка, л, 2 л
Колонка Ultra Pack B

14

20
50
100

W828-02
W828-05
W828-10

Л

Колонка Hi-Flash, L, 2 л, 3 л
Универсальная колонка, L, 2 л, 5L-S8, 3 л
Колонка Ultra Pack, C

25

20
50
100

W830-02
W830-05
W830-10

2 л

Колонка Hi-Flash, 2 л, 3 л, 4 л, 5 л
Универсальная колонка, 2 л, 5 л-S8, 3 л, 4 л, 5 л
Колонка Ultra Pack, C

35

20
50
100

W831-02
W831-05
W831-10

3 л

Колонка Hi-Flash, 3 л, 4 л, 5 л
Универсальная колонка, 5 л-S8, 3 л, 4 л, 5 л
Ultra Pack, C, D

100

20
50
100

W832-02
W832-05
W832-10

4 л

Колонка Hi-Flash, 4 л, 5 л
Универсальная колонка, 4 л, 5 л
Колонка Ultra Pack, D, E

140

20
50
100

W833-02
W833-05
W833-10

Колонка Hi-Flash, 5 л
Универсальная колонка, 5 л
Колонка Ultra Pack, D, E

200

20
50
100

Колонка для инъекций, наполненная аминокислотами

Номер продукта

Размер колонки

Для использования с

Количество оплачиваемой пробы (мл)

Весы для заказа (шт.)

W899-01
W899-05
W899-10

Колонка High-Flash, универсальная колонка S
, колонка S
Ultra Pack A

1.5

10
50
100

W895-01
W895-05
W895-10

Колонка High-Flash, S, M
Универсальная колонка, S, M
Колонка Ultra Pack A

3

10
50
100

W895-01
W895-05
W895-10

С

Колонка Hi-Flash, M, L, 2 л
Универсальная колонка, M, L
Колонка Ultra Pack B

5

10
50
100

W897-01
W897-05
W897-10

М

Колонка Hi-Flash, л, 2 л, 3 л
Универсальная колонка, л, 2 л
Колонка Ultra Pack B

14

10
50
100

W898-01
W898-05
W898-10

Л

Колонка Hi-Flash, L, 2 л, 3 л
Универсальная колонка, L, 2 л, 5L-S8, 3 л
Колонка Ultra Pack, C

25

10
50
100

W885-01
W885-05
W885-10

2 л

Колонка Hi-Flash, 2 л, 3 л, 4 л, 5 л
Универсальная колонка, 2 л, 5 л-S8, 3 л, 4 л, 5 л
Колонка Ultra Pack, C

35

10
50
100

W885-01
W885-05
W885-10

3 л

Колонка Hi-Flash, 3 л, 4 л, 5 л
Универсальная колонка, 5 л-S8, 3 л, 4 л, 5 л
Ultra Pack, C, D

100

10
50
100

W887-01
W887-05
W887-10

4 л

Колонка Hi-Flash, 4 л, 5 л
Универсальная колонка, 4 л, 5 л
Колонка Ultra Pack, D, E

140

10
50
100

W888-01
W888-05
W888-10

Колонка Hi-Flash, 5 л
Универсальная колонка, 5 л
Колонка Ultra Pack, D, E

140

10
50
100

ODS(C18) Наполненная инжекторная колонка

Номер продукта

Размер колонки

Для использования с

Количество оплачиваемой пробы (мл)

Весы для заказа (шт.)

W914-01
W914-05
W829-10

Колонка High-Flash, универсальная колонка S
, колонка S
Ultra Pack A

1

10
50
100

W915-01
W915-05
W915-10

Колонка High-Flash, S, M
Универсальная колонка, S, M
Колонка Ultra Pack A

2

10
50
100

W916-01
W916-05
W916-10

С

Колонка Hi-Flash, M, L, 2 л
Универсальная колонка, M, L
Колонка Ultra Pack B

3

10
50
100

W917-01
W917-05
W917-10

М

Колонка Hi-Flash, л, 2 л, 3 л
Универсальная колонка, л, 2 л
Колонка Ultra Pack B

12

10
50
100

W918-01
W918-05
W918-10

Л

Колонка Hi-Flash, L, 2 л, 3 л
Универсальная колонка, L, 2 л, 5L-S8, 3 л
Колонка Ultra Pack, C

20

10
50
100

W920-01
W920-05
W920-10

2 л

Колонка Hi-Flash, 2 л, 3 л, 4 л, 5 л
Универсальная колонка, 2 л, 5 л-S8, 3 л, 4 л, 5 л
Колонка Ultra Pack, C

28

10
50
100

W921-01
W921-05
W921-10

3 л

Колонка Hi-Flash, 3 л, 4 л, 5 л
Универсальная колонка, 5 л-S8, 3 л, 4 л, 5 л
Ultra Pack, C, D

80

10
50
100

W922-01
W922-05
W922-10

4 л

Колонка Hi-Flash, 5 л
Универсальная колонка, 5 л
Колонка Ultra Pack, D, E

110

10
50
100

W923-01
W923-05
W923-10

Колонка Hi-Flash, 5 л
Универсальная колонка, 5 л
Колонка Ultra Pack, D, E

160

10
50
100

Пустая инжекторная колонка

Номер продукта

Размер колонки

Для использования с

Количество оплачиваемой пробы (мл)

Весы для заказа (шт.)

W909-02
W909-05
W909-10

Колонка High Flash, S
Универсальная колонка, S

20
50
100

W905-02
W905-05
W905-10

Колонка High Flash, S, M
Универсальная колонка, S, M

20
50
100

W906-02
W906-05
W906-10

С

Колонка Hi-Flash, M, L, 2 л
Универсальная колонка, M, L

20
50
100

W907-02
W907-05
W907-10

М

Колонка Hi-Flash, л, 2 л, 3 л
Универсальная колонка, л, 2 л

20
50
100

W908-02
W908-05
W908-10

Л

Колонка Hi-Flash, 3 л
Универсальная колонка, 5 л-S8, 3 л

20
50
100

W910-02
W910-05
W910-10

2 л

Колонка Hi-Flash, 3 л, 4 л, 5 л
Универсальная колонка, 3 л, 4 л, 5 л

20
50
100

W911-02
W911-05
W911-10

3 л

Колонка Hi-Flash, 4 л, 5 л
Универсальная колонка, 4 л, 5 л

20
50
100

W912-02
W912-05
W912-10

4 л

Колонка Hi-Flash, 5 л
Универсальная колонка, 5 л
Колонка Ultra Pack, D, E

20
50
100

W913-02
W913-05
W913-10

Колонка Hi-Flash, 5 л
Универсальная колонка, 5 л
Колонка Ultra Pack, D, E

20
50
100

Аксессуары и фурнитура
Пример установки
Принадлежности для инъекционной колонки
Уплотнительное кольцо для адаптера колонки
Адсорбент
Аксессуары

Возрастные характеристики и исходы у пациентов с сердечной недостаточностью с сохраненной фракцией выброса

Резюме

История вопроса

Хотя сердечная недостаточность с сохраненной фракцией выброса (СНсФВ) считается болезнью пожилых людей, более молодые пациенты не избавлены от нее синдром.

Цели

Таким образом, в этом исследовании изучались связи между возрастом, клиническими характеристиками и исходами у пациентов с HFpEF.

Методы

Используя данные о пациентах с фракцией выброса левого желудочка ≥45% из 3 крупных исследований HFpEF (TOPCAT [Терапия антагонистами альдостерона у взрослых с сердечной недостаточностью и сохраненной систолической функцией], I-PRESERVE [Ирбесартан при сердечной недостаточности с сохраненной систолической функция] и CHARM Preserved [кандесартан цилексетил при сердечной недостаточности, оценка снижения смертности и заболеваемости]), пациенты были разделены на категории в зависимости от возраста: ≤55 лет (n = 522), от 56 до 64 лет (n = 1679), от 65 до 74 года (n = 3405), от 75 до 84 лет (n = 2464) и ≥85 лет (n = 398).В этом исследовании сравнивались клинические и эхокардиографические характеристики, а также показатели смертности и госпитализации, способ смерти и качество жизни в разных возрастных категориях.

Результаты

Более молодые пациенты (возраст ≤55 лет) с СН-сФВ чаще были мужчинами небелой расы с ожирением, тогда как пожилые пациенты с СН-сФВ чаще были белыми женщинами с более высокой распространенностью фибрилляции предсердий, артериальной гипертензии и хронической болезни почек (рСКФ < 60 мл/мин/1,73 м 2 ). Несмотря на меньшее количество сопутствующих заболеваний, у более молодых пациентов качество жизни было хуже, чем у пожилых пациентов (возраст ≥85 лет).По сравнению с пациентами в возрасте ≤55 лет у пациентов в возрасте ≥85 лет смертность была выше (отношение рисков: 6,9; 95% доверительный интервал: от 4,2 до 11,4). Однако среди умерших пациентов внезапная смерть была пропорционально наиболее распространенным видом смерти (p < 0,001) у пациентов в возрасте ≤55 лет. Напротив, пожилые пациенты (возраст ≥85 лет) чаще умирали от несердечно-сосудистых причин (34% против 20% у пациентов в возрасте ≤55 лет; p<0,001).

Выводы

По сравнению с пожилыми, более молодые пациенты с HFpEF реже были белыми, чаще мужчинами с ожирением и чаще умирали от сердечно-сосудистых причин, особенно от внезапной смерти.Напротив, пожилые пациенты с HFpEF имели больше сопутствующих заболеваний и чаще умирали от несердечно-сосудистых причин. (Терапия антагонистами альдостерона у взрослых с сердечной недостаточностью и сохраненной систолической функцией [TOPCAT]; NCT00094302; Ирбесартан при сердечной недостаточности с сохраненной систолической функцией [I-PRESERVE]; NCT00095238; Кандесартан Цилексетил при сердечной недостаточности. Оценка снижения смертности и заболеваемости [CHARM Preserve]. ]; NCT00634712)

МОТОРИЗОВАННЫЙ — P2R

DELLORTO

В наличии

Артикул: 182680 — CARBURATEUR SCOOT DELLORTO POUR SYM 50 SYMPHONY S, ST, SR, CARGO/PEUGEOT 10 TWEET 4, PEUGEOT 50 TWEET8, RS EVO16, RS EVO ГРАММ…

  • MPH

    В наличии

    Артикул : 183891 — Design sport-touring Coque extérieure moulée en matériau thermoplastique Coque Intérieure en EPS double densité (высокая…

  • MPH

    Design-8

  • MPH

    В наличии

    Артикул : 183906 — Design sport-touring Внешняя отделка из мулине в термопластическом материале Внутренний чехол из двойного плотного EPS (высокая…

  • MPH

    )..

  • MT Healmets

    В наличии

    Ссылка: 180950 — Casque Integral Mt Targo Uni Noir Brillant XS (простой Ecran Brillant Head)

  • миль в час

    — USTÉRIEURE USTEREURE: 183884 — Coque Emtérieure Moulee EN Matériau ThermoPlastique Coque Intreure EN EPS двойной плотности (высокое впитывание) 2…

  • MPH

    На складе

    Артикул: 183878 — Дизайн футуристический Coque extérieure moulée en matériau thermoplastique Coque Intérieure en EPS двойной плотности (высокая…

  • MPH

    В наличии

    53 В наличии

    Ссылка: 183879 — Дизайн FUTURISTE Coque Extérieure Moulee EN Matériau ThermoPlastique Coque Intérieure EN EPS Double Densité (Haute …

  • MPH

    В наличии

    Ссылка: 183880 — Дизайн FUTURISTE Coque Extérieure Moulee

  • MPH

    На складе

    Артикул: 183868 — Дизайн футуристический Внутренний слой из термопласта Внутренний слой из EPS двойной плотности (высокий…

  • Роль карцинина в передаче сигналов в синапсе фоторецептора дрозофилы

    Abstract

    Фоторецепторная клетка Drosophila melanogaster уже давно служит модельной системой для исследователей, изучающих, как сенсорные нейроны животных получают информацию из окружающей среды и преобразуют эту информацию в химические и электрические сигналы. Электроретинографический (ERG) анализ мутантов Drosophila помог выяснить некоторые гены, участвующие в пути зрительной трансдукции ниже по течению от фоторецепторной клетки, и теперь ясно, что передача сигналов фоторецепторной клеткой зависит от надлежащего высвобождения и повторного использования нейротрансмиттера. гистамин.В то время как транспортеры нейротрансмиттеров, ответственные за выведение гистамина и его метаболита карцинина из синаптической щели, остаются неизвестными, сильным кандидатом на роль переносчика любого субстрата является неохарактеризованный опьяненный белок. Ген в состоянии алкогольного опьянения ( и ) кодирует предполагаемый переносчик нейротрансмиттеров, который был локализован в фоторецепторных клетках у дрозофилы , а мутации в и приводят к аномальному фенотипу ERG у дрозофилы .Мутации с потерей функции ebony , гена, необходимого для синтеза карцинина у Drosophila , подавляют компоненты мутантного ine ERG фенотипа, в то время как мутации с потерей функции tan , необходимого гена для гидролиза карцинина у Drosophila , не влияют на фенотип ERG у мутантов in . Мы также показываем, что, скармливая мухам дикого типа карцинин, мы можем дублировать компоненты мутантных и ERG.Наконец, мы демонстрируем, что лечение агонистами рецептора H 3 или обратными агонистами восстанавливает несколько компонентов мутантного фенотипа ine ERG. Здесь мы приводим фармакологические и генетические эпистатические доказательства того, что и кодируют переносчик карцининовых нейротрансмиттеров. Мы также предполагаем, что колебания, наблюдаемые в мутантных и следах ERG, являются результатом аберрантной активности предполагаемого рецептора H 3 .

    Резюме автора

    Во время передачи сигналов в нервной системе отдельные нервные клетки передают информацию друг другу посредством сложного процесса, называемого синаптической передачей.Эта коммуникация включает высвобождение специфического нейротрансмиттера в синаптическую щель, который затем запускает передачу сигналов в нижестоящих нейронах путем связывания и активации специфических рецепторов клеточной поверхности. Для прекращения нейронального сигнала нейротрансмиттер должен быть быстро удален из синаптической щели. Это осуществляется с помощью двух механизмов: нейротрансмиттер может разрушаться или модифицироваться или трансмиттер может поглощаться пресинаптическим нейроном и упаковываться в везикулы для повторного использования.В сложном глазу плодовой мушки D. melanogaster фоторецепторная клетка реагирует на свет и высвобождает гистамин в синаптическую щель. Этот сигнал прерывается удалением гистамина из синапса и ферментативным превращением гистамина в карцинин. Мы показали, что недостаточно просто модифицировать нейротрансмиттер гистамина, важно также удалить карцинин из синапса фоторецептора. Неспособность адекватно удалить карцинин приводит к дефектам в процессе визуальной трансдукции.Более того, работа предполагает, что сам карцинин модулирует зрение, регулируя выброс гистамина в синапс.

    Образец цитирования: Гэвин Б.А., Арруда С.Е., Дольф П.Дж. (2007) Роль карцинина в передаче сигналов в синапсе фоторецептора дрозофилы . PLoS Genet 3(12): е206. https://doi.org/10.1371/journal.pgen.0030206

    Редактор: Грег Барш, Медицинский факультет Стэнфордского университета, США

    Получено: 15 августа 2007 г.; Принято: 5 октября 2007 г .; Опубликовано: 7 декабря 2007 г.

    Авторские права: © 2007 Gavin et al.Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Финансирование: Это исследование финансировалось грантом Национального института неврологических расстройств и инсульта R01NS047276.

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Сокращения: ЭРГ, электроретинограф

    Введение

    Чрезвычайно сложная регуляция связана с синтезом, высвобождением, активностью и рециркуляцией или деградацией нейротрансмиттера в нервной системе животных.Эта регуляция может включать деградацию нейротрансмиттера в синапсах [1], обратный захват нейромедиатора пресинаптическими нейронами [2], рециркуляцию нейромедиатора соседними клетками [3] и/или активацию рецепторов, которые запускают петли положительной/отрицательной обратной связи, что приводит к увеличению /снижение выброса нейротрансмиттера в пресинаптических нейронах [4]. Многие из механизмов и компонентов механизмов, связанных с этой регуляцией, хорошо сохранились у разных видов, от Caenorhabditis elegans до человека [5].D. melanogaster часто используется при изучении динамики нейротрансмиттеров из-за его податливой генетики, сильных фенотипов при наличии дефектов нейротрансмиссии и его чувствительности к многочисленным нейрофармакологическим соединениям, которые, как было показано, оказывают аналогичные эффекты на людей (для обзора см. [6] ).

    Основным нейротрансмиттером, выделяемым фоторецепторными клетками Drosophila , является гистамин [7], который биосинтезируется из гистидина ферментом гистидиндекарбоксилазой (Hdc), обнаруженным в фоторецепторной клетке [8].При возбуждении светом фоторецепторная клетка деполяризуется и высвобождает гистамин, который затем связывается с постсинаптическим управляемым гистамином хлоридным каналом, что приводит к гиперполяризации постсинаптического нейрона [9,10]. Каждый синаптический картридж окружен тремя глиальными клетками, которые инвагинируют в окончания фоторецепторов с помощью пальцевидных выступов, известных как головчатые структуры [11]. Хотя точное место обратного захвата гистамина в настоящее время неизвестно, считается, что гистамин, остающийся в синаптической щели, быстро поглощается глиальными клетками, возможно, в месте этих головчатых структур [12].В глиальных клетках этот гистамин преобразуется ферментом N-β-аланилдофаминсинтазой, кодируемым геном черного дерева у Drosophila , в β-аланил-гистамин, также известный как карцинин [3,13]. Затем этот карцинин высвобождается глиальной клеткой в ​​виде «неактивного» конъюгата гистамина, опять же, возможно, в месте расположения головчатых структур, где он затем поглощается пресинаптическим нейроном. Оказавшись в фоторецепторной клетке, карцинин преобразуется ферментом N-β-аланилдофамингидролазой, кодируемым геном tan , обратно в исходный нейротрансмиттер гистамин [13,14].Предполагается, что комбинация биосинтеза гистамина с помощью гистидиндекарбоксилазы и рециркуляции гистамина ферментами черного дерева и коричневого цвета определяет общий пул гистамина, доступного в синапсе фоторецепторной клетки. Транспортеры, ответственные за поглощение гистамина глиальными клетками и интернализацию карцинина фоторецепторными клетками, в настоящее время неизвестны.

    Считается, что ген и кодирует предполагаемый переносчик нейротрансмиттеров, и были секвенированы и идентифицированы две кДНК и [15], [16].Более короткая кДНК, ine-RB , кодирует белок Ine-P2, тогда как более длинная кДНК, ine-RA , кодирует белок Ine-P1, который содержит дополнительно ~300 аминокислот на своем N-конце. Функция дополнительной N-концевой области ine-P1 в настоящее время неизвестна. Несмотря на усилия по идентификации нейротрансмиттера, транспортируемого в состоянии опьянения в трансфецированных ооцитах Xenopus laevis, субстрат белка в состоянии алкогольного опьянения остается неуловимым [17]. Мутации в гене и ine приводят к увеличению скорости возникновения долговременной фасилитации в личиночном нервно-мышечном синапсе [18], а также к увеличению возбудимости нейронов, связанному с мутациями в гене Shaker , которые кодирует α-субъединицу калиевого канала [19].Считается, что оба этих фенотипа возбудимости нейронов вызваны дефектным обратным захватом неизвестного нейротрансмиттера и, таким образом, чрезмерной стимуляцией постсинаптических нейронов. Третий и менее понятный фенотип, связанный с мутациями и , проявляется в виде аберрантной электроретинограммы (ERG) [15,20]. ERG измеряют массовый ответ сетчатки глаза на световой стимул, а ERG мутантов и характеризуется несколькими дефектами, включая наиболее заметные серии сильных колебаний в присутствии света [15,20].Недавно в превосходном и всестороннем обзоре гистаминергической нейронной передачи сигналов у членистоногих было высказано предположение, что ген ine у Drosophila может кодировать переносчик карцининовых нейротрансмиттеров [21]. Здесь мы предоставляем генетические и фармакологические доказательства, связывающие фенотип, связанный с мутантным ine-, с накоплением карцинина в фоторецепторной синаптической щели и с активностью предполагаемого рецептора H 3 в глазу Drosophila .

    Материалы и методы

    Припасы для мух

    Repo-Gal4 , «Long» — GMR-Gal4 , W 1118 , Tan 1 , Tan 2 , E 1 , E 11 , or Pbac лески были получены из Bloomington Stock Center. Мутанты мух Hdc P218 и ort 5 были получены от W.Pak (Университет Пердью), а линии трансгенных мух UAS-ine-RB и ine 2 были получены от M. Stern (Университет Райса). Все запасы содержались в постоянной темноте при комнатной температуре. Мух, несущих две или три мутации/трансгена, получали стандартными генетическими методиками. Все мухи дикого типа принадлежали к фону w 1118 .

    Электроретинография

    Мух анестезировали путем воздействия углекислого газа и иммобилизовали во вращающемся диске с помощью капли расплавленной миристиновой кислоты (Akros).Для записи изменений напряжения внутри глаза электрод, заполненный гелем Signa (Parker Labs), помещали на поверхность глаза, а второй электрод, заполненный гелем, осторожно вставляли в грудную клетку. Для световых процедур использовалась галогенная лампа, управляемая затвором модели T132 Uniblitz. Все световые обработки, если не указано иное, проводились с использованием фильтра 580 нм и длились 4 с. Чтобы уменьшить влияние экзогенных источников гистамина на мух ine 2 Hdc P218 во время анализа ЭРГ, этих животных перед тестированием голодали в течение 24 ч.Чтобы вызвать пики деполяризации у мух ort 5 , мухам подавали два 4-секундных импульса света 480 нм, за которыми следовали два 4-секундных импульса света 580 нм, и во время второго импульса брали след. Импульс 580 нм для анализа. Изменения напряжения усиливали с помощью усилителя DAM50 (World Precision Instruments), записывали с помощью Powerlab 4/30 (AD Instruments, Колорадо-Спрингс, Колорадо) и анализировали с помощью программного обеспечения Chart 5 (AD Instruments). Частоту колебаний определяли путем подсчета и усреднения количества спайков реполяризации, наблюдаемых в пределах 0.2 с воздействия света в записи ЭРГ in 2 или обработанных карцинином мух.

    Лечение наркомании

    Тиоперамид, иммепип и гистамин были получены от Sigma, а карцинин был получен от Peninsula Laboratories. Все соединения были восстановлены в стерилизованной воде для длительного хранения. Мух обрабатывали в течение ночи во флаконах, содержащих Kimwipes, пропитанных 200 мкл 1% раствора сахарозы с лекарственным соединением или без него. Гистамин доставляли мухам в концентрации 10% [22].Использовали тиоперамид и иммепип в концентрации 0,5%, а карцинин в концентрации 5% или 10%. Мух голодали в течение 24 ч перед обработкой лекарством.

    ПЦР с обратной транскриптазой

    РНК очищали либо из эмбрионов, либо из голов взрослых мух фона w 1118 с использованием набора RNeasy Mini Kit (Qiagen Sciences). кДНК получали из очищенной РНК с использованием MMLV-обратной транскриптазы (Fisher Scientific). Прямые праймеры, специфичные либо к транскриптам ine-RA , либо к ine-RB , и обратный праймер, общий для обоих транскриптов, были получены от Integrated DNA Technologies.Прямой праймер ine-RA был ATCGATGGCCACTTCCGGATTACA, прямой праймер ine-RB был ATCAGTTGCCACTCCCAGTTTCCA, а обратный праймер, использованный для получения продукта ПЦР из обоих транскриптов, был TATCCTATGCAGGCCAGGACGAAT. Продукты получали и амплифицировали с помощью ПЦР с использованием полимеразы Taq, буферов, полученных от Invitrogen, и термоциклера TECHNE, TC-312 (Bartoworld Scientific) с использованием следующих параметров в течение 35 циклов (94°C в течение 30 с, 55°C в течение 30 с). с и 72 °С в течение 90 с).Продукты ПЦР разделяли в 1% агарозном геле и затем окрашивали бромистым этидием.

    Результаты

    Глио- или фоторецептор-специфическая экспрессия белка в состоянии алкогольного опьянения спасает фенотип колебаний ЭРГ

    Запись ЭРГ мухи дикого типа (рис. 1А) содержит рецепторный компонент или реакцию деполяризации при воздействии света, а также переходные пики, указывающие на реакцию ниже фоторецепторной клетки (стрелки, рис. 1А). ЭРГ мутантов и ine содержит интактный компонент рецептора, но с добавлением начального всплеска деполяризации (незакрашенная стрелка, рис. 1B) и заметных колебаний, наложенных на ответ деполяризации (рис. 1B).Эти колебания имеют широкий диапазон частот от 40 до 90 Гц. Эти мутанты также обладают уменьшенными переходными процессами включения и выключения (стрелки, Figure 1B), что указывает на нарушение синаптической передачи фоторецепторов. Наконец, эти мутантные ERG и ine часто обнаруживают гиперполяризацию после реакции на свет (стрелка, рис. 1В). Мы наблюдали все эти ранее описанные фенотипы ERG при использовании мух с аллелем ine 2 или ine 3 . Аллель ine 3 является результатом делеции большей части открытой рамки считывания ine , общей для ine-RA и ine-RB [16], а мутация, связанная с ine 2 была идентифицирована как нонсенс-мутация в кодоне 125 гена ine и, как полагают, влияет только на изоформу, кодируемую ine-RA- [23].Поскольку аллель ine 3 связан со сниженной жизнеспособностью, и поскольку мы не смогли обнаружить заметной разницы между кривыми ERG мух ine 2 и ine 3 , мы использовали исключительно 9201 9201 ine 2 линия мух для всех наших экспериментов и генетических скрещиваний.

    Рисунок 1. Спасение ine 2 — Ассоциированные колебания с экспрессией INE как в глиальных, так и в фоторецепторных клетках ine 2 , экспрессирующий кДНК UAS-ineRB в фоторецепторах, и (D) ine 2 , экспрессирующий кДНК UAS-ineRB в глиальных клетках.Стрелки указывают на включение и выключение переходных процессов, присутствующих в (A) записях дикого типа, но не (B) ine 2 мутантных записях. Реакция резкой деполяризации (незакрашенная стрелка), реакция гиперполяризации (закрашенная стрелка) и осцилляции присутствуют в (B) и 2 записях ЭРГ. Обратите внимание, что экспрессия ine либо в фоторецепторных, либо в глиальных клетках приводит к восстановлению ine 2 -ассоциированных колебаний, включению и выключению переходных процессов (стрелки) и реакции гиперполяризации.(E) Измерение мРНК ine-RA и ine-RB у эмбрионов дикого типа или взрослых голов. 1 = продукт ine-RA из взрослых голов, 2 = продукт ine-RA из эмбрионов, 3 = продукт ine-RB из взрослых голов и 4 = продукт ine-RB из эмбрионов. Продукт ПЦР ine-RA составляет 336 п.н., тогда как продукт ine-RB составляет 338 п.н. Обратите внимание, что очень мало мРНК ine-RB обнаружено в головах взрослых.

    https://дои.org/10.1371/journal.pgen.0030206.g001

    Эксперименты по регистрации внутриклеточного напряжения предполагают, что колебания, наблюдаемые у ine мутантов, возникают в фоторецепторной клетке и что они не являются результатом синаптической обратной связи [24]. Однако, если и действительно кодируют транспортер нейротрансмиттера, его экспрессия и локализация не обязательно ограничиваются фоторецепторными клетками, поскольку транспортеры нейромедиатора часто функционируют из соседних глиальных клеток. В самом деле, предыдущее исследование продемонстрировало, что экспрессии ine либо в нейронах, либо в глиальных клетках было достаточно для восстановления нескольких мутантных ine -ассоциированных дефектов в нервно-мышечном соединении [23].Чтобы подтвердить, что опьяненный белок необходим в синапсах фоторецепторных клеток, мы проверили, можно ли восстановить мутантный фенотип ine 2 путем экспрессии транскрипта ineRB в фоторецепторных и глиальных клетках. Трансгенная линия мух UAS-ine-RB [23, 25] содержит кДНК ine-RB под контролем восходящей последовательности активатора дрожжевого транскрипционного фактора Gal4. Эти мух UAS-ine-RB будут экспрессировать Ine-P2 только при скрещивании со второй линией мух, экспрессирующих Gal4.Используемые линии Gal4 были «длинными» — GMR-GAL4 , которые экспрессируют белок Gal4 специфически в фоторецепторных клетках [26], и repo-GAL4 , которые экспрессируют Gal4 в глиальных клетках [27]. Сильное спасение фенотипа ine 2 ERG наблюдалось, когда ine-RB экспрессировался либо в фоторецепторных, либо в глиальных клетках (рис. 1C и 1D) по сравнению с невосстановленным ine 2 или диким типом. контрольные ( w 1118 ) ЭРГ (рис. 1А и 1В).Как и ожидалось, трансген UAS-ine-RB не смог спасти фенотип ine 2 , если не присутствовал ни один трансген GAL4 (неопубликованные данные). Колебания, наблюдаемые в записях ЭРГ у этих спасенных трансгенных животных, либо отсутствовали, либо были значительно снижены, а ответ гиперполяризации также был значительно снижен. Наконец, восстановленные кривые ЭРГ содержали более крупные переходные процессы включения и выключения, чем невосстановленные контрольные образцы ine 2 (стрелки, рис. 1C и 1D).Экспрессия ine-RB в глиальных клетках, по-видимому, дает более сильное и более стабильное восстановление фенотипа ine 2 ERG, чем при экспрессии в фоторецепторных клетках. Это может быть связано с более сильной экспрессией транскрипционного фактора Gal4 у мух repo-GAL4 , чем у животных GMR-GAL4 , или может быть связано с необходимостью полноразмерного ine-RA , а не ine. -RB , экспрессия в фоторецепторных клетках. Также удивительно, что экспрессия ine-RB обладает способностью восстанавливать фенотип ine 2 ERG, поскольку ранее считалось, что транскрипт ine-RB остается интактным у мутантных мух ine 2 . 25].Эти результаты позволяют предположить, что ine-RB в норме экспрессируется только на низких уровнях по сравнению с ine-RA и что сверхэкспрессия ine-RB достаточна для компенсации потери ine-RA , связанной с ine. 2 мутанты. Эксперименты ПЦР с обратной транскриптазой подтверждают эти подозрения; ine-RB экспрессируется на низких уровнях во взрослых головах дикого типа по сравнению с сильной экспрессией ine-RB в развивающемся эмбрионе (рис. 1E).Транскрипт ine-RA был обнаружен на высоких уровнях как у эмбрионов дикого типа, так и у взрослых голов (рис. 1Е).

    Гистамин необходим для

    ине мутантного фенотипа ERG

    Способность ине 2 восстанавливать реакцию ЭРГ путем экспрессии опьяненного белка в фоторецепторных и глиальных клетках позволяет предположить, что опьяневший действует в первую очередь на участке фоторецепторной клетки в глазу. Считается, что гистамин является преобладающим нейротрансмиттером, передающим сигналы между фоторецепторными клетками и ламинарными нейронами второго порядка в оптической доле [28], и возможно, что в состоянии алкогольного опьянения он служит переносчиком гистамина.Однако предыдущие исследования показали, что, когда опьяненный белок табачной аскариды Manduca sexta, , который имеет значительную гомологию с опьяненным белком Drosophila , экспрессируется в яйцах Xenopus laevis, он не может транспортировать гистамин через клеточную мембрану [17]. ]. Тем не менее, эти авторы предполагают, что может потребоваться второй неизвестный белок, чтобы помочь пьяным в правильной транспортной функции нейротрансмиттеров, или что пьяные могут иметь разные субстраты у Manduca по сравнению с Drosophila .Таким образом, гистамин все же мог быть субстратом у пьяных дрозофил . Гистамин образуется в результате активности гистидиндекарбоксилазы, кодируемой геном Hdc у дрозофилы (рис. 2А). Мутации в гене Hdc , например, в случае аллеля Hdc P218 , приводят к тому, что мухи обладают нарушенной синаптической передачей фоторецепторов, о чем свидетельствует отсутствие переходных процессов включения и выключения в их ЭРГ ([8], и рисунок 2С).Приблизительно 80% мух, которые были гомозиготными по обоим аллелям Hdc P218 и ine 2 , демонстрировали ЭРГ без колебаний (рис. 2D) по сравнению с ine 2 контролями). Был небольшой процент (~20%) Hdc P218 ine 2 мух, которые демонстрировали слабые или задержанные колебания. Тем не менее, ERG от этих мух, которые демонстрировали это слабое спасение, также обладали переходными процессами включения и выключения, что позволяет предположить, что аллель Hdc P218 либо не был полностью пенетрантен у этих двойных мутантов, либо что их пища обеспечивала внешний источник гистамина.Это неудивительно, так как известно, что фоторецепторы дрозофилы восстанавливают некоторые функции из-за экзогенного гистамина, поглощаемого в незначительных количествах с пищей [22]. ERG от Hdc P218 ine 2 также часто не имеют реакции гиперполяризации, характерной для ine 2 мух (рис. 2D). Эти данные свидетельствуют о том, что продукция или передача сигналов гистамина играет важную роль в фенотипе осцилляции и гиперполяризации, наблюдаемом у следов ine 2 .

    Рисунок 2. Синтез гистамина, но не постсинаптическая передача сигналов гистамина, необходим для и мутантного фенотипа ERG

    (A) Упрощенная диаграмма, показывающая синтез и активность гистамина в глазу Drosophila . HD, гистидин; Hdc, гистидиндекарбоксилаза; НА, гистамин; Ort, гистаминозависимый хлоридный канал; ПК, фоторецепторная клетка; LC, постсинаптическая ламинарная клетка. Гистамин образуется гистидиндекарбоксилазой из гистидина в фоторецепторной клетке.Затем он высвобождается и воздействует на управляемый гистамином хлоридный канал на постсинаптической ламинарной клетке, запуская передачу сигналов ниже по течению в глазу. ERG записи от (B) INE 2 , (C) HDC P218 , (D) INE 2 HDC P218 , (E) ORT 5 и (f ) ине 2 ;орт 5 летает. Обратите внимание, что Hdc P218 восстанавливает ine 2 -осцилляции, а мутации или — нет.(G) Записи ЭРГ от 76% или 5 мух демонстрируют сильные всплески деполяризации. Закрашенные стрелки указывают на реакцию гиперреполяризации. Все мухи обладали белыми глазами из-за наличия мутации w 1118 .

    https://doi.org/10.1371/journal.pgen.0030206.g002

    Постсинаптический рецептор гистамина у дрозофилы представляет собой управляемый гистамином хлоридный канал (рис. 2А), и субъединица этого канала кодируется или переходный ген ( или ) [10].Оба аллеля ort 5 и ort Pbac приводят к снижению активности этого гистаминового рецептора у Drosophila , о чем свидетельствует отсутствие переходных процессов включения и выключения на их кривых ЭРГ ([10] и рис. 2E). ). Если и кодируют переносчик гистаминового нейротрансмиттера, то сниженная функция этого белка может привести к избытку гистамина в синаптической щели, и этот избыток нейротрансмиттера может воздействовать на этот постсинаптический гистаминовый рецептор, каким-то образом вызывая наблюдаемые колебания.Если бы это было так, то ине 2 ; Двойные мутанты или должны были иметь уменьшенные осцилляции. Однако ни ine 2 ;ort 5 (рис. 2F), ни ine 2 ;ort Pbac (неопубликованные данные) двойные мутанты не проявляли восстановления осцилляционного или гиперполяризационного компонентов 92 914 2 Записи ЭРГ, указывающие на то, что колебания не возникают из-за передачи сигналов гистамина в нижестоящих нейронах.Более того, поскольку мутации или блокируют передачу сигналов в ламинарных нейронах, эти данные согласуются с колебаниями, генерируемыми в фоторецепторных клетках. Удивительно, но аллель ort 5 , являющийся результатом мутации сдвига рамки считывания и, следовательно, вероятно, являющийся нулевым аллелем для этого гена [10], часто проявляет собственные сильные спайки деполяризации в рецепторном компоненте своей ЭРГ. (Рисунок 2G). Следовательно, мутации в Hdc , которые блокируют образование гистамина, спасают и 2 , тогда как мутации в или , которые все еще позволяют синтез гистамина, не спасают.

    Черное дерево Требуется активность для ине Мутантный фенотип ERG

    Удаление мутантного фенотипа ERG ine при введении мутаций Hdc , но не ort , предполагает, что гистамин участвует в формировании фенотипа ine 2 ERG, но гистамин находится ниже по течению. оптическая доля нет. Путь рециркуляции гистамина в глазах хорошо изучен [13,14,29,30].Было показано, что после высвобождения в синаптическую щель гистамин быстро поглощается соседними глиальными клетками и превращается с помощью β-аланил-дофаминсинтазы, кодируемой геном ebony , в β-аланил-гистамин, также известный как как карцинин (рис. 3А). Затем этот карцинин транспортируется в пресинаптические фоторецепторные клетки и снова превращается в гистамин с помощью β-аланил-дофамин-гидролазы, кодируемой геном tan , для использования в качестве рециклируемого источника нейротрансмиттера (рис. 3А).Мутации tan и ebony в Drosophila связаны со значительным уменьшением размера переходных процессов включения и выключения на трассировках ЭРГ (рис. 3C и 3E) из-за потери этого рециркулируемого пула гистамина в глазу. Введение мутаций tan 2 (неопубликованные данные) или tan 1 в фон ine 2 не оказало никакого влияния на уменьшение размера колебаний или реакции гиперполяризации по сравнению с 2 мутантов по отдельности (сравните рисунок 3B с рисунком 3D).Однако двойные мутанты ine 2 ;ebony 1 (неопубликованные данные) или ine 2 ;ebony 11 продемонстрировали полное восстановление осцилляции фенотипа у всех протестированных мух (сравните рисунок 3B). . Эти данные в сочетании с тем фактом, что синтез гистамина необходим для презентации мутантного фенотипа ERG у мух ine 2 , обеспечивают генетические доказательства того, что карцинин участвует в генерации ine 2 -ассоциированных колебаний.

    Рисунок 3. Эбеновое дерево, но не желтовато-коричневый, активность необходима для и мутантного фенотипа ERG

    (A) Упрощенная диаграмма, показывающая рециркуляцию гистамина в глазу дрозофилы . НА, гистамин; СА, карцинин; ПК, фоторецепторная клетка; LC — постсинаптическая ламинарная клетка и GC — глиальная клетка. Гистамин поглощается из синаптической щели глиальными клетками, где он превращается черным деревом в карцинин. Затем карцинин доставляется к фоторецепторным клеткам, где он снова превращается в гистамин под действием фермента загара.ERG записи из (B) INE 2 , (C) Tan, (d) Tan 1 ; INE 2 Ebony 11 Ebony 11 и (f) ине 2 ;черное дерево 11 летает. Обратите внимание, что ine 2 осцилляции спасены мутациями в ebony , но не в tan.

    https://doi.org/10.1371/journal.pgen.0030206.g003

    Обработка мух дикого типа и

    черного дерева Мух карцинином приводит к аномалиям ЭРГ

    Если и кодируют переносчик нейротрансмиттера карцинина, как предполагают приведенные выше генетические данные, то потенциальной причиной аберрантных фенотипов ERG, наблюдаемых у мутантов и , может быть накопление карцинина в синаптической щели фоторецептора.Чтобы проверить, способен ли карцинин индуцировать ine 2 -подобный фенотип ERG у животных дикого типа, мух w 1118 обрабатывали 5% карцинином в течение ночи, а затем подвергали анализу ERG. Приблизительно 35% w 1118 мух, обработанных карцинином, демонстрировали случайные слабые колебания или короткие всплески деполяризации/реполяризации в ответе фоторецепторов их следов ЭРГ (рис. 4B и 4C, по сравнению с рис. 4A).Хотя эти всплески не имеют постоянной частоты, в отличие от колебаний, наблюдаемых в записях и 2 , индуцированные карцинином нарушения ЭРГ никогда не наблюдались у голодающих мух, не подвергавшихся лечению. Если карцинин вводили черным 11 мухам, у которых отсутствует способность синтезировать карцинин из гистамина, у них неожиданно обнаруживались аномальные следы ЭРГ. У всех черных 11 мух, обработанных карцинином, проявлялись фенотипы, напоминающие наблюдаемые в ine 2 записи ЭРГ, включая резкие всплески деполяризации в ответ на световой ответ, слабые осцилляции и пик гиперполяризации при прекращении действия света. (Рисунок 4E и 4F, по сравнению с рисунком 4D).Колебания, наблюдаемые у обработанных карцинином мутантов черного дерева 11 , хотя и появлялись ненадолго во время начала воздействия света, наблюдались с той же частотой, что и обнаруженные в ine 2 записях ЭРГ (63 импульса/с). . Как обсуждается ниже, возможный механизм, лежащий в основе этих индуцированных карцинином нарушений ЭРГ, может включать сенсибилизацию предполагаемого рецептора гистамина/карцинина.

    Рисунок 4. Обработка карцинином индуцирует ine 2 -подобный фенотип ERG у дикого типа и черного дерева 11 Мухи

    Записи ERG необработанных (A) дикого типа и (D) черного дерева мухи и обработанные 5% карцинином (B, C) дикого типа и (D, E) черные 11 мухи.Обратите внимание, что в то время как у необработанных мух дикого типа и черного дерева 11 в записях ЭРГ отсутствуют колебания и реакция гиперполяризации в ответ на свет, записи ЭРГ от мух дикого типа, обработанных 5% карцинином в течение ночи, демонстрируют слабые колебания (стрелки) примерно в 35% случаев. подопытных животных и записи ЭРГ черного дерева 11 мух, обработанных 5% карцинином, обнаруживают всплески деполяризации в ответ на свет (незакрашенная стрелка), а также слабые осцилляции (стрелка) и гиперреполяризацию при прекращении действия света ( наконечник стрелы).

    https://doi.org/10.1371/journal.pgen.0030206.g004

    Фармакологическое спасение

    ине 2 Мутантный фенотип ERG

    Если опьянение действительно служит переносчиком карцинина, и если карцинин действительно накапливается в синаптической щели у мутантов ine 2 , то этот неочищенный карцинин, по-видимому, каким-то образом действует на какой-то синаптический рецептор, чтобы инициировать этот фенотип аберрантных колебаний. Эксперименты ine 2 ;ort 5 позволяют предположить, что этот рецептор не является постсинаптическим гистаминозависимым хлоридным каналом.У млекопитающих и различных других систем позвоночных пресинаптические гистаминергические нейроны часто содержат свои собственные рецепторы гистамина, известные как рецепторы H 3 . Рецептор H 3 представляет собой рецептор, связанный с G-белком, который был впервые идентифицирован в 1983 году Arrang et al. [4] и теперь известно, что он действует как пресинаптический ауторецептор, который ингибирует высвобождение гистамина из гистаминергических нейронов головного мозга (обзор см. в [31]). Таким образом, рецепторы H 3 служат для негативной регуляции высвобождения и синтеза гистамина в присутствии высоких уровней гистамина в синаптической щели.Хотя рецептор H 3 еще не идентифицирован у Drosophila , существует несколько генов-кандидатов, которые могут кодировать такой предполагаемый рецептор. Существует множество хорошо изученных фармацевтических соединений, которые действуют как агонисты, антагонисты или обратные агонисты рецептора H 3 in vivo у млекопитающих, а недавно карцинин был идентифицирован как обратный агонист этого рецептора у мышей [32]. Было показано, что вместо того, чтобы уменьшать высвобождение гистамина, как это происходит в случае связывания гистамина с рецептором H 3 , карцинин оказывает противоположное действие и индуцирует как синтез гистамина, так и его высвобождение из пресинаптических гистаминергических нейронов in vivo.

    Возможный сценарий, объясняющий колебания, наблюдаемые в ine 2 ERG, заключается в том, что гистамин и неочищенный карцинин конкурируют за связывание с предполагаемыми рецепторами H 3 , что приводит к противоположным реакциям сигнального каскада в фоторецепторной клетке. Если это так, то нарушение этого баланса связывания гистамина и карцинина с предполагаемым рецептором H 3 в глазах ine 2 мух должно привести к восстановлению колебаний ЭРГ.Действительно, обработка ine 2 мух 10% карцинином привела к восстановлению колебаний у 35% мух (неопубликованные данные), а обработка ine 2 мух 0,5% тиоперамидом, другим хорошо охарактеризованным препаратом. и мощный обратный агонист рецептора H 3 у млекопитающих приводил к постоянному и полному исчезновению колебаний в кривых ЭРГ у всех протестированных мух (сравните рисунок 5A с рисунком 5C). Кроме того, обработка орт 5 летает с 0.5% тиоперамид приводил к исчезновению пиков деполяризации, связанных с или 5 (неопубликованные данные). Удивительно, но обработка контрольных мух дикого типа 0,5% тиоперамидом привела к потере переходных процессов включения и выключения в их ERG (сравните рисунок 5B с рисунком 5D).

    Рисунок 5. Триоперамид и безмятежность для обработки колебаний в INE 2 INE 2 ERGS и ABLATES Переходные данные в W 1118 FLIES

    ERG записи из необработанного (A) INE 2 и (B) W 1118 и 0.5% обработанных тиоперамидом (C) ine 2 и (D) w 1118 и (E) 0,5% обработанных иммепипом ine 2 мух. Обратите внимание, что в то время как записи ЭРГ у необработанных мутантов ine 2 демонстрируют осцилляции и реакцию гиперполяризации, обработка ine 2 мух в течение ночи 0,5% тиоперамидом приводит к потере осцилляций и переходным процессам включения и выключения, но не к гиперполяризации. ответ (стрелка).(E) Обработка мух ine 2 в течение ночи 0,5% иммепипа приводит к потере колебаний и реакции гиперполяризации у> 50% протестированных мутантов ine 2 .

    https://doi.org/10.1371/journal.pgen.0030206.g005

    Также должна быть возможность нарушить гипотетический баланс связывания гистамина и карцинина с фоторецептором, специфичным для клетки H 3 рецептором в ine 2 путем введения агониста рецептора H 3 , такого как сам гистамин.Действительно, обработка мух ine 2 10% гистамином (неопубликованные данные) или 0,5% иммепипа (рис. 5E), другим мощным агонистом рецептора H 3 , приводила к сильному восстановлению колебаний у > 50% мух. проверено. Иногда слабые осцилляции и пики деполяризации все еще наблюдались у мух ine 2 , обработанных иммепипом или гистамином (рис. 5E). Ни лечение гистамином, ни лечение иммепипом не оказывали сильного или последовательного влияния на переходные процессы включения и выключения, наблюдаемые в контрольных ERG дикого типа.Поскольку известно, что иммепип и тиоперамид являются специфическими и обратными агонистами рецептора H 3 млекопитающих, эти фармакологические эксперименты предполагают, что рецептор H 3 может существовать у Drosophila и что аномальная стимуляция этого рецептора H 3 происходит в глазах мутантов in 2 Drosophila .

    Обсуждение

    Наши результаты показывают, что предполагаемый переносчик нейротрансмиттеров, кодируемый геном ine у Drosophila , транспортирует метаболит гистамина карцинин.Используя генетический эпистаз, мы показываем, что колебания, наблюдаемые в мутантных и ERG, требуют активности гистидиндекарбоксилазы и фермента, синтезирующего карцинин, ebony, но не фермента, гидролизующего карцинин, tan. Мы также обнаружили, что обработка мух дикого типа карцинином может фенокопировать компоненты мутантного фенотипа ine ERG. Наконец, спасая фенотип, связанный с ine 2 , с помощью препаратов, нацеленных на рецептор H 3 млекопитающих, мы предоставляем фармакологические доказательства присутствия предполагаемого рецептора H 3 у Drosophila , который может быть ответственным за осцилляции ЭРГ, наблюдаемые у мух, несущих мутации в гене и ine .

    Функции белка в состоянии алкогольного опьянения в фоторецепторах и глиальных клетках

    Предыдущие исследования, включающие регистрацию внутриклеточного напряжения мутантов и , привели авторов к заключению, что колебания, наблюдаемые в ЭРГ мутантов и , были результатом дефекта, происходящего внутри фоторецепторной клетки [24]. Мы смогли подтвердить эти выводы, экспрессируя ine специфически в фоторецепторных клетках и продемонстрировав сохранение колебаний, связанных с ine 2 .Транспортеры нейротрансмиттеров часто способны функционировать либо от пресинаптического нейрона, либо от соседних глиальных клеток, как показано в нервно-мышечном соединении у мутантов и [23]. Мы обнаружили, что специфичная для глиальных клеток экспрессия гена ine у мух ine 2 приводит к полному восстановлению ine мутантного фенотипа ERG. Было несколько неожиданно, что экспрессия ine в глиальных клетках спасла фенотипы ine 2 , поскольку было показано, что в глиальных клетках отсутствует tan белок и, следовательно, они не могут превращать карцинин обратно в рециклированный пул гистамина [30]. .Однако возможно, что глиальные клетки действительно экспрессируют следовые количества фермента tan для гидролиза карцинина и выработки возобновляемого источника гистамина для фоторецепторных клеток, а также возможно, что опьяненный белок экспрессируется неавтономным образом и может быть транспортируется от глиальных клеток к фоторецепторам глаза мухи.

    Тот факт, что запись ЭРГ может демонстрировать осцилляции, несколько удивителен. ЭРГ не регистрирует электрический ответ отдельного фоторецептора, а скорее представляет собой коллективную меру фотоответа сетчатки.Таким образом, если мутантные и -ассоциированные дефекты ЭРГ действительно локализованы в синапсах фоторецепторов, как предполагают наши данные и данные предыдущих лабораторий, то можно было бы ожидать, что разные фоторецепторы будут возбуждаться/ингибироваться в разные моменты времени, что в конечном итоге приводит к колебания просто самоуничтожаются. Тот факт, что осцилляции действительно наблюдаются и, по-видимому, обусловлены дефектом, происходящим в синапсе фоторецептора, предполагает существование нехарактерной и сложной синхронизации де-/реполяризации фоторецепторных клеток.

    Постсинаптическое накопление карцинина в

    глазу дрозофилы вызывает ine 2 -ассоциированный мутантный фенотип ERG

    Отсутствие сохранения ine 2 -ассоциированных колебаний у мух, несущих дополнительные мутации в гене постсинаптического рецептора гистамина или , обнаружение мутантных ine колебаний в одиночных фоторецепторных клетках [24], и наши наблюдения, что мутантный ine фенотип может быть спасен, когда ine экспрессируется в фоторецепторах, все вместе убедительно свидетельствует о том, что колебательный фенотип, вероятно, является результатом дефекта, происходящего внутри самого фоторецептора.Кроме того, путем скрещивания ine 2 животных с Hdc P218 мух мы продемонстрировали, что связанные колебания ine 2 зависят от синтеза гистамина. Все эти результаты показывают, что гистамин каким-то образом способствует аберрантной ЭРГ, наблюдаемой у и 2 мух, и что гистамин, по-видимому, действует на пресинаптические фоторецепторные клетки, индуцируя этот фенотип осцилляции. Дальнейший эпистатический анализ также показал, что для генерации колебаний в ЭРГ ине 2 необходима активность черного, а не желтого цвета (рис. 6А).Эти генетические эксперименты согласуются с тем, что и кодируют либо импортера карцинина, обнаруженного в фоторецепторной клетке, либо экспортера карцинина, обнаруженного в глиальных клетках. Гомология опьянения с другими известными переносчиками нейротрансмиттеров Na + /Cl (которые импортируют нейротрансмиттер в клетки) [16] позволяет предположить, что опьяненный белок транспортирует карцинин в фоторецептор, а не из глиальных клеток.

    Рисунок 6. Возможная роль isebried в трансдукции сетчатки в Drosophila

    (а) эпистатическая диаграмма, иллюстрирующая то, как мутации в HDC или Ebony , но не Tan , Rescue INE 2 сопутствующие колебания.

    (B) Модель динамики гистамина/карцинина в глазу дикого типа Drosophila . В глазу мухи дикого типа фоторецепторная клетка деполяризуется в ответ на свет, что приводит к высвобождению гистамина в синаптическую щель. Этот гистамин затем связывается и активирует постсинаптические управляемые гистамином хлоридные каналы на ламинарных нейронах, тем самым поддерживая индуцированный светом сигнальный каскад в глазу. Избыток гистамина может связываться с предполагаемым пресинаптическим рецептором H 3 , что приводит к ингибированию притока кальция и дальнейшему высвобождению нейротрансмиттера.В конце концов большая часть гистамина удаляется из синаптической щели глиальными клетками, где он превращается в карцинин под действием фермента черного дерева. Затем карцинин поглощается фоторецепторными клетками с помощью переносчика нейротрансмиттеров в состоянии алкогольного опьянения, где он снова превращается в гистамин с помощью фермента загара.

    (C) Модель динамики гистамина/карцинина в глазу ine -мутанта Drosophila . У мутантов и ine высвобождение гистамина фоторецепторными клетками, поглощение гистамина глиальными клетками и превращение гистамина в карцинин не затрагиваются.Однако удаление карцинина из синаптической щели считается дефектным. Это приводит к избытку карцинина в синаптической щели, который затем связывается с предполагаемым рецептором H 3 , обеспечивая вход кальция, в конечном итоге стимулируя выработку и высвобождение гистамина из фоторецепторной клетки. Недавно высвобожденный гистамин и избыток карцинина конкурируют за связывание с рецептором H 3 , что приводит к колебаниям между ингибированием и высвобождением кальциевых каналов, в конечном итоге вызывая реакции реполяризации/деполяризации, которые в совокупности способствуют наблюдаемым колебаниям, наблюдаемым у ine мутанта. ЭРГ.

    https://doi.org/10.1371/journal.pgen.0030206.g006

    Хотя известно, что черное дерево действует на несколько субстратов, таких как дофамин, с образованием β-аланил-дофамина [13], потребность в синтезе гистамина для Поддержание ине 2 -ассоциированных колебаний позволяет предположить, что за колебания, наблюдаемые в ине 2 ЭРГ, каким-то образом ответственен β-аланилгистамин или карцинин. Однако следует отметить, что мутаций черного дерева было недостаточно для спасения гиперполяризационной реакции, наблюдаемой в мутантных ине следах ERG (рис. 3F).Происхождение этого гиперполяризационного ответа до сих пор неясно, и потребуются дальнейшие исследования, чтобы выяснить его точное значение. У мутантов tan можно было бы предсказать накопление карцинина. Однако это накопление не приводит к записи ЭРГ, аналогичной записи ine 2 . Скорее всего, это связано с наличием функционального опьяненного белка у мутантных мух tan , который должен эффективно выводить карцинин из синаптической щели для деградации в фоторецепторной клетке.

    Путем обработки карцинином ine 11 мух дикого типа и ine 11 и последующей индукции компонентов фенотипа ine 2 -ERG мы получили дополнительные доказательства того, что резкий всплеск деполяризации, осцилляции и реакция гиперполяризации все наблюдаемые в ine 2 -ERG обусловлены накоплением карцинина в синаптической щели фоторецептора. Хотя колебания, наблюдаемые у мух дикого типа, получавших лечение карцинином, не совсем точно повторяют колебания, наблюдаемые в записях ЭРГ и 2 , по-видимому, трудно воспроизвести баланс карцинина и гистамина, наблюдаемый в глазах ине 2 . животных.Действительно, обработка мух дикого типа более высокими (10 %) или более низкими (1 %) концентрациями карцинина была менее эффективной для индукции колебаний, чем описанная доза 5 % карцинина (неопубликованные данные).

    Вполне возможно, что карцинин расщепляется или модифицируется мухой до того, как соединение становится способным оказывать свое действие на фоторецепторную клетку. Чтобы устранить активность одного фермента, который, как известно, участвует в метаболизме карцинина, мух tan 1 обрабатывали 5% карцинином в течение ночи.Удивительно, но ни у одной из мух tan 1 , обработанных карцинином, не было выявлено аберрантного фенотипа ERG (неопубликованные данные). Удивительно, что обработка карцинином оказала сильное влияние на мух черного дерева 11 , но не желтовато-коричневого 1 , фона. Хотя результаты этих рыжевато-коричневого 1 и черного дерева 11 экспериментов по лечению карцинином оказались неожиданными, одно из возможных объяснений может заключаться в регуляции клиренса/деградации карцинина.Мухи tan 1 предположительно страдают от постоянного избытка карцинина даже до экзогенной обработки карцинином, и эти мухи, чтобы уменьшить свою чувствительность к этому соединению, могут, следовательно, снизить уровни предполагаемого рецептора карцинина, увеличить их скорость деградации карцинина, или повысить уровень выпитого белка для клиренса карцинина. Однако черные 11 мухи относительно «наивны» к воздействию карцинина, так как их способность синтезировать это соединение значительно снижена, и в результате у этих животных может быть повышен уровень предполагаемого рецептора карцинина, снижение уровней рецепторов в состоянии алкогольного опьянения или снижение деградации карцинина, что в конечном итоге делает их более чувствительными к эффектам лечения карцинином.

    Остается выяснить, обусловлены ли все мутантные и -ассоциированные фенотипы, включая повышенную возбудимость нейронов [19], [23] и повышенную чувствительность к осмотическому стрессу [25], неспособностью этих мух к транспортный карцинин. Возможно, что опьяненный белок переносит другие соединения, которые, возможно, имеют общие черты конъюгации β-аланина. Это может помочь объяснить, почему ни один из наиболее распространенных нейротрансмиттеров не поглощался и -трансфицированными ооцитами Xenopus [17].Чтобы помочь в подтверждении того, что опьянение действительно является переносчиком нейротрансмиттеров карцинина, необходимо будет провести эксперименты in vitro, такие как анализы поглощения нейротрансмиттеров. Кроме того, следует изучить способность белка, выпитого в состоянии алкогольного опьянения, поглощать другие β-аланил-нейротрансмиттеры/осмолиты.

    Что такое

    ine 2 — Ассоциированные колебания?

    Колебания, присутствующие в ответе фоторецепторов ине 2 ЭРГ, проявляются в виде резких пиков деполяризации/реполяризации, и этот фенотип колебаний зависит как от синтеза гистамина, так и от активности черного дерева (рис. 6А), и чувствителен к препаратам, нацеленным на млекопитающих. H 3 рецепторы.Вызывает недоумение тот факт, что синтез одного метаболита, карцинина, может быть ответственен как за пики деполяризации, так и за реполяризацию, наблюдаемые в и мутантных ERG. Мы предполагаем, что эти колебания являются результатом аберрантной передачи сигналов с участием как карцинина, так и гистамина на предполагаемом рецепторе H 3 у Drosophila (рис. 6B и 6C). Рецепторы H 3 являются необычным примером семейства рецепторов, связанных с G-белком, поскольку они обладают частичной конститутивной активностью, что приводит к постоянному небольшому проценту стимулированных G-белков [33], которые вызывают снижение синтеза и высвобождения гистамина [33]. 34], а также уменьшение притока внеклеточного кальция [35,36,37].Присутствие агониста рецептора H 3 , такого как гистамин, вызывает повышение активности связанного с ним G-белка и, следовательно, более сильное ингибирование как высвобождения гистамина, так и притока кальция. Таким образом, синаптический гистамин служит негативным регулятором собственного высвобождения и вызывает легкую реполяризацию стимулированного пресинаптического гистаминергического нейрона путем ингибирования пресинаптических кальциевых каналов. Считается, что обратный агонист рецептора H 3 действует путем блокирования конститутивной активности рецептора H 3 , что приводит к освобождению от контрольной точки высвобождения гистамина, а также снятию ограничений на приток кальция [38].Недавно было показано, что карцинин обладает способностью действовать как обратный агонист пресинаптических рецепторов H 3 у мышей [32]. Хотя для подтверждения этой гипотезы необходимы дальнейшие значительные исследования, мы предполагаем, что гистамин и карцинин оказывают противоположное влияние на состояние поляризации гистаминергической фоторецепторной клетки, активируя или ингибируя пресинаптические кальциевые каналы через предполагаемый рецептор Drosophila H 3 . В то время как недавний поиск генома Drosophila не выявил каких-либо прямых гомологов метаботропным рецепторам гистамина позвоночных [39], ген CG7918 был указан в качестве возможного кандидата для кодирования такого рецептора, и этот ген имеет сильную гомологию с генами, кодирующими H 3 рецепторы у млекопитающих.Кроме того, колебания, связанные с ine 2 , демонстрируют чувствительность к агонистам рецепторов H 3 млекопитающих и обратным агонистам, что усиливает возможность того, что рецептор H 3 действительно существует у Drosophila . До сих пор неясно, каково происхождение чувствительных к тиоперамиду пиков деполяризации, наблюдаемых в или 5 ЭРГ. Наличие этих чувствительных к тиоперамиду спайков в или 5 записях ЭРГ подразумевает необходимость некоторого постсинаптического ретроградного сигнала для стабильности ЭРГ, и этот или -зависимый сигнал может быть вовлечен в сенсибилизацию предполагаемого H 3 рецептор.

    Было неожиданно, что обработка тиоперамидом мух дикого типа привела к потере переходных процессов включения и выключения в их следах ЭРГ. Возможно, что высвобождение гистамина было настолько экстремальным в присутствии сильнодействующего тиоперамида, что уровни гистамина в глазу почти истощились, что привело к нарушению нижестоящих сигнальных событий. Действительно, было показано, что лечение мышей высокими концентрациями карцинина, который действует как обратный агонист рецепторов H 3 , подобно тиоперамиду, приводит к значительному снижению общего уровня гистамина в мозге обработанных мышей [32].Эта модель непрямого истощения гистамина также постулируется у мух-мутантов ebony . Отсутствие переходных процессов включения и выключения в записях ЭРГ мутанта черного дерева приписывается нормальному высвобождению гистамина фоторецепторными клетками, но впоследствии этот гистамин теряет способность «захватываться» конъюгацией β-аланина, что в конечном итоге приводит к диффундированию гистамина. из глаза [13]. Интересно, что экспрессия коклюшного токсина в фоторецепторных и ламинарных нейронах дрозофилы приводит к аналогичной потере переходных процессов включения и выключения на дорожках ЭРГ, и считается, что это результат инактивации неизвестного рецептора, связанного с G-белком, обнаруженного в фоторецепторе. клетки, которые вряд ли являются родопсином [40].Вполне возможно, что коклюшный токсин действовал внутри фоторецепторных клеток на предполагаемый рецептор H 3 в этом исследовании, что приводило к отсутствию отрицательной обратной связи на синтез/высвобождение гистамина, что в конечном итоге вызывало истощение/истощение пулов гистамина. Потребуются дальнейшие исследования, чтобы подтвердить или опровергнуть наличие чувствительного к гистамину/карцинину рецептора H 3 в фоторецепторных клетках Drosophila .

    Дополнительная информация

    Регистрационные номера

    Национальный центр биотехнологической информации (NCBI) Entrez (http://www.ncbi.nlm.nih.gov/sites/gquery) инвентарные номера для генов, обсуждаемых в этой статье: ebony , 42521; ХДК , 36076; и , 33659; или , 54910; и желто-коричневый , 4478.

    Вклад авторов

    BAG, SEA и PJD разработали и разработали эксперименты. BAG провела эксперименты. BAG и PJD проанализировали данные. BAG написал статью.

    Каталожные номера

    1. 1. Massoulie J, Sussman J, Bon S, Silman I (1993)Структура и функции ацетилхолинэстеразы и бутирилхолинэстеразы.Prog Brain Res 98: 139–146.
    2. 2. Iversen LL, Jarrott B, Simmonds MA (1971) Различия в поглощении, накоплении и метаболизме (+)- и (-)-норадреналина. Br J Pharmacol 43: 845–855.
    3. 3. Ричардт А., Рыбак Дж., Сторткул К.Ф., Майнерцхаген И.А., Ховеманн Б.Т. (2002)Белок черного дерева в нервной системе дрозофилы: экспрессия оптических нейропилей в глиальных клетках. J Comp Neurol 452: 93–102.
    4. 4. Arrang JM, Garbarg M, Schwartz JC (1987)Автоингибирование синтеза гистамина, опосредованное пресинаптическими h4-рецепторами.Неврология 23: 149–157.
    5. 5. Mullen GP, ​​Mathews EA, Saxena P, Fields SD, McManus JR, et al. (2006) Ген snf-11 Caenorhabditis elegans кодирует натрий-зависимый переносчик ГАМК, необходимый для клиренса синаптической ГАМК. Мол Биол Ячейка 17: 3021–3030.
    6. 6. Nichols CD (2006) Нейробиология Drosophila melanogaster, нейрофармакология и то, как муха может информировать об открытии лекарств для центральной нервной системы. Pharmacol Ther 112: 677–700.
    7. 7.Hardie RC (1987) Является ли гистамин нейромедиатором в фоторецепторах насекомых? J Comp Physiol [A] 161: 201–213.
    8. 8. Бург М.Г., Сарти П.В., Колианц Г., Пак В.Л. (1993)Генетическая и молекулярная идентификация гена гистидиндекарбоксилазы дрозофилы, необходимого для синтеза передатчика фоторецептора. EMBO J 12: 911–919.
    9. 9. Гиссельманн Г., Пуш Х., Ховеманн Б.Т., Хатт Х. (2002) Две кДНК, кодирующие управляемые гистамином ионные каналы у D. melanogaster. Nat Neurosci 5: 11–12.
    10. 10. Gengs C, Leung H-T, Skingsley DR, Iovchev MI, Yin Z, et al. (2002) Мишенью синаптической передачи фоторецепторов дрозофилы является управляемый гистамином хлоридный канал, кодируемый ort (hclA). [опечатка появляется в J Biol Chem. 20 декабря 2002 г.; 277 (51): 50214.]. J Biol Chem 277: 42113–42120.
    11. 11. Старк В., Карлсон С. (1986) Ультраструктура головчатых выступов в оптическом нейропиле клеточной ткани Diptera Res. 246.: 481–486.
    12. 12. Фабиан-Файн Р., Верстрекен П., Хизингер П., Хорн Дж., Костылева Р. и соавт.(2003) Endophilin способствует поздней стадии эндоцитоза при глиальных инвагинациях в окончаниях фоторецепторов Drosophila. J Neurosci 23: 10732–10744.
    13. 13. Borycz J, Borycz JA, Loubani M, Meinertzhagen IA (2002) гены tan и ebony регулируют новый путь метаболизма передатчика на окончаниях фоторецепторов мух. J Neurosci 22: 10549–10557.
    14. 14. True JR, Yeh SD, Hovemann BT, Kemme T, Meinertzhagen IA, et al. (2005) Drosophila tan кодирует новую гидролазу, необходимую для пигментации и зрения.Генетика PLoS 1: e63.
    15. 15. Burg MG, Geng C, Guan Y, Koliantz G, Pak WL (1996) Ген rosA дрозофилы, который при мутации вызывает аберрантное колебание фоторецептора, кодирует новый гомолог транспортера нейротрансмиттера. Дж. Нейрогенет 11: 59–79.
    16. 16. Soehnge H, Huang X, Becker M, Whitley P, Conover D, et al. (1996)Переносчик нейротрансмиттера, кодируемый геном опьянения дрозофилы. Proc Natl Acad Sci U S A 93: 13262–13267.
    17. 17.Chiu C, Ross LS, Cohen BN, Lester HA, Gill SS (2000) Опьяненный транспортерным белком опосредует гиперосмотические стимулы посредством внутриклеточной передачи сигналов. J Exp Biol 203: 3531–3546.
    18. 18. Ян Ю.Н., Ян Л.И. (1978)Генетическое рассечение краткосрочного и долгосрочного облегчения в нервно-мышечном соединении дрозофилы. Proc Natl Acad Sci U S A 75: 515–519.
    19. 19. Стерн М., Ганецки Б. (1992)Идентификация и характеристика опьянения, гена, влияющего на возбудимость нейронов у дрозофилы.Дж. Нейрогенет 8: 157–172.
    20. 20. Wu CF, Wong F (1977)Частотные характеристики в зрительной системе дрозофилы: генетическое рассечение компонентов электроретинограммы. J Gen Physiol 69: 705–724.
    21. 21. Стюарт А., Борич Дж., Мейнерцхаген И. (2007)Динамика передачи сигналов в синапсах гистаминергических фоторецепторов членистоногих. Прог Нейробиол.
    22. 22. Melzig J, Burg M, Gruhn M, Pak WL, Buchner E (1998)Избирательное поглощение гистамина восстанавливает фото- и механорецепторную функцию мутанта Drosophila с дефицитом гистидиндекарбоксилазы.J Neurosci 18: 7160–7166.
    23. 23. Huang Y, Stern M (2002) In vivo свойства транспортера нейромедиатора, кодируемого Drosophila в состоянии алкогольного опьянения. J Neurosci 22: 1698–1708.
    24. 24. Wilcox M, Pak W (1977)Генетическое изменение мембраны фоторецептора, приводящее к индуцированным светом колебаниям, наложенным на потенциал рецептора.
    25. 25. Хуан X, Хуан И, Чиннаппан Р, Боккини С, Гастин М.С. и др. (2002) Переносчик нейротрансмиттера/осмолита, кодируемый дрозофилой в состоянии алкогольного опьянения: двойная роль в контроле возбудимости нейронов и реакции на осмотический стресс.Генетика 160: 561–569.
    26. 26. Вернет М.Ф., Лабхарт Т., Бауманн Ф., Маццони Э.О., Пишо Ф. и др. (2003) Гомоторакс переключает функцию фоторецепторов дрозофилы с цветных на датчики поляризованного света. Ячейка 115: 267–279.
    27. 27. Xiong W, Okano H, Patel N, Blendy J, Montell C (1994) Repo кодирует специфический для глии белок гомеодомена, необходимый в нервной системе дрозофилы. Гены Дев 8: 981–994.
    28. 28. Hardie RC (1989)Активируемый гистамином хлоридный канал, участвующий в нейротрансмиссии в синапсах фоторецепторов.Природа 339: 704–706.
    29. 29. Ричардт А., Кемме Т., Вагнер С., Шварцер Д., Марахиэль М.А. и соавт. (2003)Ebony, новая нерибосомальная пептидная синтетаза для конъюгации бета-аланина с биогенными аминами у дрозофилы. J Biol Chem 278: 41160–41166.
    30. 30. Вагнер С., Хесединг С., Шлахта К., Тру Дж. Р., Принц Х. и др. (2007) Фоторецепторы дрозофилы экспрессируют цистеинпептидазу tan. J Comp Neurol 500: 601–611.
    31. 31. Леурс Р., Баккер Р.А., Тиммерман Х., де Эш IJP (2005)Гистаминовый рецептор h4: от клонирования генов до препаратов рецептора h4.Nature Reviews Drug Discovery 4: 107–120.
    32. 32. Chen Z, Sakurai E, Hu W, Jin C, Kiso Y и др. (2004) Фармакологическое действие карцинина на гистаминергические нейроны головного мозга. Br J Pharmacol 143: 573–580.
    33. 33. Мориссе С., Руло А., Линьо Х., Гбаху Ф., Тардивель-Лакомб Дж. и др. (2000) Высокая конститутивная активность нативных рецепторов h4 регулирует нейроны гистамина в головном мозге. Природа 408: 860–864.
    34. 34. Gomez-Ramirez J, Ortiz J, Blanco I (2002) Пресинаптические ауторецепторы h4 модулируют синтез гистамина через путь цАМФ.Мол Фармакол 61: 239–245.
    35. 35. Такешита Ю., Ватанабэ Т., Саката Т., Мунаката М., Исибаси Х. и др. (1998) Гистамин модулирует активируемые высоким напряжением кальциевые каналы в нейронах, диссоциированных от туберомаммилярного ядра крысы. Неврология 87: 797–805.
    36. 36. Blandizzi C, Colucci R, Tognetti M, De Paolis B, Del Tacca M (2001) Опосредованное рецептором h4 ингибирование высвобождения ацетилхолина в кишечнике: фармакологическая характеристика путей передачи сигнала.Naunyn Schmiedebergs Arch Pharmacol 363: 193–202.
    37. 37. Seyedi N, Mackins CJ, Machida T, Reid AC, Silver RB и др. (2005)Гистамин h4-рецептор-индуцированное ослабление экзоцитоза норадреналина: снижение активности протеинкиназы опосредует снижение внутриклеточного кальция. J Pharmacol Exp Ther 312: 272–280.
    38. 38. Морено-Дельгадо Д., Торрент А., Гомес-Рамирес Дж., Де Эш И., Бланко И. и др. (2006)Конститутивная активность ауторецепторов h4 модулирует синтез гистамина в головном мозге крыс через путь цАМФ/ПКА.Нейрофармакология 51: 517–523.
    39. 39. Roeder T (2003) Метаботропные рецепторы гистамина – ничего для беспозвоночных? Евр. Дж. Фармакол 466: 85–90.
    40. 40. Fitch C, DeSousa S, O’Day P, Neubert T, Plantilla C, et al. (1993) Экспрессия коклюшного токсина у дрозофилы изменяет зрительную реакцию и блокирует пищевое поведение. Сотовая сигнализация 5: 187–207.

    Кристофер Булл Грейнджер | Ученые @ Герцог

    Кристофер Булл Грейнджер

    Профессор медицины

    Исследование:
    В первую очередь меня интересует проведение и методология крупных рандомизированных клинических испытаний болезней сердца.Я руководил рядом крупных международных клинических исследований сердечных приступов, нестабильной стенокардии, сердечной недостаточности и мерцательной аритмии. Я руководил клиническими исследованиями разжижителей крови и коронарных вмешательств при сердечных приступах, профилактики инсульта при мерцательной аритмии и профилактики сердечного приступа у пациентов с ишемической болезнью сердца. Я был соруководителем проекта «Реперфузия острого инфаркта миокарда в отделениях неотложной помощи Каролины» (RACE), который представляет собой общегосударственную программу штата Северная Каролина по улучшению реперфузионной помощи при остром инфаркте миокарда.Я являюсь председателем программы Миссия Американской кардиологической ассоциации: программа Lifeline по улучшению лечения сердечных приступов на национальном уровне, а также руководящего комитета Американского колледжа кардиологов / Американской кардиологической ассоциации по лечению сердечных приступов. Я также изучал влияние генетической изменчивости на болезни сердца. Я работаю с Национальным институтом здравоохранения и Федеральным управлением по лекарственным средствам над оценкой сердечных заболеваний и новых лекарств. Я разработал инструменты для прогнозирования пациентов с риском смерти, сердечного приступа и потребности в госпитализации.

    Текущие назначения и связи

    • Образование, обучение и сертификация

    • Предыдущие назначения и связи

    • В новостях

    • Награды и награды

    • Тематические рубрики

    • Избранные гранты

    • Внешние связи

    • Избранные публикации

    Некоторая информация по этому профилю была собрана автоматически из баз данных Duke и внешних источников.(На нашей странице «О нас» объясняется, как это работает.) Если вы обнаружите проблему с информацией, напишите по адресу [email protected] и сообщите нам об этом. Мы ответим быстро.

    Управление этим профилем Добавить данные на мой сайт

    © 2022 Университет Дьюка | Условия использования | Работает на ВИВО

    SEC.gov | Порог частоты запросов превысил

    Чтобы обеспечить равный доступ для всех пользователей, SEC оставляет за собой право ограничивать запросы, исходящие от необъявленных автоматических инструментов.Ваш запрос был идентифицирован как часть сети автоматизированных инструментов, выходящих за рамки допустимой политики, и будет управляться до тех пор, пока не будут предприняты действия по объявлению вашего трафика.

    Пожалуйста, заявите о своем трафике, обновив свой пользовательский агент, включив в него информацию о компании.

    Чтобы ознакомиться с рекомендациями по эффективной загрузке информации с SEC.gov, включая последние документы EDGAR, посетите сайт sec.gov/developer. Вы также можете подписаться на рассылку обновлений по электронной почте в программе открытых данных SEC, включая передовые методы, которые делают загрузку данных более эффективной, и SEC.gov, которые могут повлиять на процессы загрузки по сценарию. Для получения дополнительной информации обращайтесь по адресу [email protected]

    Для получения дополнительной информации см. Политику конфиденциальности и безопасности веб-сайта SEC. Благодарим вас за интерес, проявленный к Комиссии по ценным бумагам и биржам США.

    Идентификатор ссылки: 0.5dfd733e.1648777253.ac5d76b

    Дополнительная информация

    Политика безопасности Интернета

    Используя этот сайт, вы соглашаетесь на мониторинг и аудит безопасности.В целях безопасности и для обеспечения того, чтобы общедоступные услуги оставались доступными для пользователей, эта правительственная компьютерная система использует программы для мониторинга сетевого трафика для выявления несанкционированных попыток загрузить или изменить информацию или иным образом нанести ущерб, включая попытки отказать в обслуживании пользователям.

    Несанкционированные попытки загрузки информации и/или изменения информации в любой части этого сайта строго запрещены и подлежат судебному преследованию в соответствии с Законом о компьютерном мошенничестве и злоупотреблениях от 1986 года и Законом о защите национальной информационной инфраструктуры от 1996 года (см.S.C. §§ 1001 и 1030).

    Чтобы гарантировать, что наш веб-сайт хорошо работает для всех пользователей, SEC отслеживает частоту запросов контента SEC.gov, чтобы гарантировать, что автоматический поиск не повлияет на способность других получать доступ к контенту SEC.gov. Мы оставляем за собой право блокировать IP-адреса, отправляющие чрезмерные запросы. Текущие правила ограничивают количество пользователей до 10 запросов в секунду, независимо от количества компьютеров, используемых для отправки запросов.

    Если пользователь или приложение отправляет более 10 запросов в секунду, дальнейшие запросы с IP-адреса (адресов) могут быть ограничены на короткий период.После того, как количество запросов упадет ниже порогового значения на 10 минут, пользователь может возобновить доступ к контенту на SEC.gov. Эта практика SEC предназначена для ограничения чрезмерных автоматических поисков на SEC.gov и не предназначена и не ожидается, что она повлияет на отдельных лиц, просматривающих веб-сайт SEC.gov.

    Обратите внимание, что эта политика может измениться, поскольку SEC управляет SEC.gov, чтобы обеспечить эффективную работу веб-сайта и его доступность для всех пользователей.

    Примечание: Мы не предлагаем техническую поддержку для разработки или отладки процессов загрузки по сценарию.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.